FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623679_at:

>probe:Drosophila_2:1623679_at:306:125; Interrogation_Position=538; Antisense; AGCCGGGCGGAATAGGTGCCTCCTA
>probe:Drosophila_2:1623679_at:729:301; Interrogation_Position=542; Antisense; GGGCGGAATAGGTGCCTCCTAATAT
>probe:Drosophila_2:1623679_at:42:365; Interrogation_Position=547; Antisense; GAATAGGTGCCTCCTAATATGACAT
>probe:Drosophila_2:1623679_at:413:535; Interrogation_Position=552; Antisense; GGTGCCTCCTAATATGACATTTAAC
>probe:Drosophila_2:1623679_at:84:695; Interrogation_Position=571; Antisense; TTTAACAAATGCTTCCTCCTAACGT
>probe:Drosophila_2:1623679_at:168:661; Interrogation_Position=573; Antisense; TAACAAATGCTTCCTCCTAACGTTT
>probe:Drosophila_2:1623679_at:72:3; Interrogation_Position=575; Antisense; ACAAATGCTTCCTCCTAACGTTTAT
>probe:Drosophila_2:1623679_at:264:167; Interrogation_Position=577; Antisense; AAATGCTTCCTCCTAACGTTTATCT
>probe:Drosophila_2:1623679_at:632:51; Interrogation_Position=579; Antisense; ATGCTTCCTCCTAACGTTTATCTAT
>probe:Drosophila_2:1623679_at:651:341; Interrogation_Position=581; Antisense; GCTTCCTCCTAACGTTTATCTATTT
>probe:Drosophila_2:1623679_at:133:631; Interrogation_Position=584; Antisense; TCCTCCTAACGTTTATCTATTTCAA
>probe:Drosophila_2:1623679_at:30:645; Interrogation_Position=599; Antisense; TCTATTTCAATATCCCTCAGCCGAC
>probe:Drosophila_2:1623679_at:642:17; Interrogation_Position=602; Antisense; ATTTCAATATCCCTCAGCCGACAAG
>probe:Drosophila_2:1623679_at:98:249; Interrogation_Position=606; Antisense; CAATATCCCTCAGCCGACAAGTGTG

Paste this into a BLAST search page for me
AGCCGGGCGGAATAGGTGCCTCCTAGGGCGGAATAGGTGCCTCCTAATATGAATAGGTGCCTCCTAATATGACATGGTGCCTCCTAATATGACATTTAACTTTAACAAATGCTTCCTCCTAACGTTAACAAATGCTTCCTCCTAACGTTTACAAATGCTTCCTCCTAACGTTTATAAATGCTTCCTCCTAACGTTTATCTATGCTTCCTCCTAACGTTTATCTATGCTTCCTCCTAACGTTTATCTATTTTCCTCCTAACGTTTATCTATTTCAATCTATTTCAATATCCCTCAGCCGACATTTCAATATCCCTCAGCCGACAAGCAATATCCCTCAGCCGACAAGTGTG

Full Affymetrix probeset data:

Annotations for 1623679_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720