FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623680_at:

>probe:Drosophila_2:1623680_at:260:513; Interrogation_Position=2079; Antisense; GTGATGGCCACGGAGCCAGCTGCTT
>probe:Drosophila_2:1623680_at:167:567; Interrogation_Position=2117; Antisense; GGCAGCCAATGGATCCGAGCAGCAG
>probe:Drosophila_2:1623680_at:509:115; Interrogation_Position=2137; Antisense; AGCAGGAGTTCATCTTGGTTGGCGA
>probe:Drosophila_2:1623680_at:368:607; Interrogation_Position=2165; Antisense; TGATGAGCCAGGAGTCTCGCGACAT
>probe:Drosophila_2:1623680_at:394:325; Interrogation_Position=2183; Antisense; GCGACATGTGCAGCCAGCTTTCGGG
>probe:Drosophila_2:1623680_at:54:339; Interrogation_Position=2215; Antisense; GCTATGTGTCCTACGGCGATTTCCA
>probe:Drosophila_2:1623680_at:215:575; Interrogation_Position=2229; Antisense; GGCGATTTCCATCCGTACTTTGATC
>probe:Drosophila_2:1623680_at:270:305; Interrogation_Position=2241; Antisense; CCGTACTTTGATCTGCTGACGCAAA
>probe:Drosophila_2:1623680_at:3:611; Interrogation_Position=2257; Antisense; TGACGCAAAACAGGCGATTCGCGCT
>probe:Drosophila_2:1623680_at:707:461; Interrogation_Position=2272; Antisense; GATTCGCGCTTAGGAAGACCGGCAG
>probe:Drosophila_2:1623680_at:408:411; Interrogation_Position=2288; Antisense; GACCGGCAGGTCTTTGGAGATTCCC
>probe:Drosophila_2:1623680_at:524:415; Interrogation_Position=2487; Antisense; GAGCCACGAAAGGAGGAGCCACAAA
>probe:Drosophila_2:1623680_at:330:221; Interrogation_Position=2569; Antisense; AAGTGGAAACCCCACAGCCTCTGGA
>probe:Drosophila_2:1623680_at:66:155; Interrogation_Position=2582; Antisense; ACAGCCTCTGGAGCAGTCAAAACTG

Paste this into a BLAST search page for me
GTGATGGCCACGGAGCCAGCTGCTTGGCAGCCAATGGATCCGAGCAGCAGAGCAGGAGTTCATCTTGGTTGGCGATGATGAGCCAGGAGTCTCGCGACATGCGACATGTGCAGCCAGCTTTCGGGGCTATGTGTCCTACGGCGATTTCCAGGCGATTTCCATCCGTACTTTGATCCCGTACTTTGATCTGCTGACGCAAATGACGCAAAACAGGCGATTCGCGCTGATTCGCGCTTAGGAAGACCGGCAGGACCGGCAGGTCTTTGGAGATTCCCGAGCCACGAAAGGAGGAGCCACAAAAAGTGGAAACCCCACAGCCTCTGGAACAGCCTCTGGAGCAGTCAAAACTG

Full Affymetrix probeset data:

Annotations for 1623680_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720