FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623681_at:

>probe:Drosophila_2:1623681_at:530:489; Interrogation_Position=1038; Antisense; GTACTTCTGCATGACGCAACCGAAT
>probe:Drosophila_2:1623681_at:328:25; Interrogation_Position=1076; Antisense; ATATGGAACATGGACTGCGCTACAA
>probe:Drosophila_2:1623681_at:65:575; Interrogation_Position=1101; Antisense; GGCGAGACGTCCTGAGAAATCCTCT
>probe:Drosophila_2:1623681_at:94:525; Interrogation_Position=564; Antisense; GGGCATTGCCGTGCAGGATATCACT
>probe:Drosophila_2:1623681_at:633:543; Interrogation_Position=579; Antisense; GGATATCACTTTGGCAGGACACTCA
>probe:Drosophila_2:1623681_at:542:591; Interrogation_Position=626; Antisense; TGGGTGCCCAACTTTTTGCCAAAGA
>probe:Drosophila_2:1623681_at:416:63; Interrogation_Position=697; Antisense; ATGTGTCGCACCACCGATATTTTGG
>probe:Drosophila_2:1623681_at:687:627; Interrogation_Position=788; Antisense; TGCCACTGGGTCACATCGATATCTA
>probe:Drosophila_2:1623681_at:197:201; Interrogation_Position=851; Antisense; AACCTGGCTGCGAGTCCAAGATCTG
>probe:Drosophila_2:1623681_at:55:453; Interrogation_Position=870; Antisense; GATCTGCAGTCACATGTATCCATTT
>probe:Drosophila_2:1623681_at:518:689; Interrogation_Position=894; Antisense; TATTCTGTTCATGGAGGCTCTCATC
>probe:Drosophila_2:1623681_at:63:517; Interrogation_Position=923; Antisense; GTGTGATGATCCCAGCTACCAAGTG
>probe:Drosophila_2:1623681_at:642:307; Interrogation_Position=959; Antisense; CCAAGTTCCGACAGGGCGATTGTAA
>probe:Drosophila_2:1623681_at:599:33; Interrogation_Position=997; Antisense; ATCAACATTGGACTCATCTACCCAG

Paste this into a BLAST search page for me
GTACTTCTGCATGACGCAACCGAATATATGGAACATGGACTGCGCTACAAGGCGAGACGTCCTGAGAAATCCTCTGGGCATTGCCGTGCAGGATATCACTGGATATCACTTTGGCAGGACACTCATGGGTGCCCAACTTTTTGCCAAAGAATGTGTCGCACCACCGATATTTTGGTGCCACTGGGTCACATCGATATCTAAACCTGGCTGCGAGTCCAAGATCTGGATCTGCAGTCACATGTATCCATTTTATTCTGTTCATGGAGGCTCTCATCGTGTGATGATCCCAGCTACCAAGTGCCAAGTTCCGACAGGGCGATTGTAAATCAACATTGGACTCATCTACCCAG

Full Affymetrix probeset data:

Annotations for 1623681_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720