FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623683_at:

>probe:Drosophila_2:1623683_at:610:371; Interrogation_Position=115; Antisense; GAAGAGCAAGCGCATCATGGTCGTA
>probe:Drosophila_2:1623683_at:59:207; Interrogation_Position=122; Antisense; AAGCGCATCATGGTCGTACTGGAAA
>probe:Drosophila_2:1623683_at:295:517; Interrogation_Position=147; Antisense; GTGTGGTCAGTGGACATCAGTTTAA
>probe:Drosophila_2:1623683_at:678:91; Interrogation_Position=165; Antisense; AGTTTAATGCTTTTCGCGATCGCTT
>probe:Drosophila_2:1623683_at:329:721; Interrogation_Position=18; Antisense; TTGCACAATAATTTCAGCGGCATAT
>probe:Drosophila_2:1623683_at:194:451; Interrogation_Position=182; Antisense; GATCGCTTGGCCGACAAATTGGAGA
>probe:Drosophila_2:1623683_at:152:3; Interrogation_Position=199; Antisense; ATTGGAGATAATACGCTTCGATCCG
>probe:Drosophila_2:1623683_at:311:343; Interrogation_Position=213; Antisense; GCTTCGATCCGTACATTCAACAGGA
>probe:Drosophila_2:1623683_at:243:267; Interrogation_Position=233; Antisense; CAGGAAAGCCTTTATCGTGAACGCA
>probe:Drosophila_2:1623683_at:199:633; Interrogation_Position=264; Antisense; TCCGCAGCGCCTAAGATAACCATTT
>probe:Drosophila_2:1623683_at:519:121; Interrogation_Position=33; Antisense; AGCGGCATATTTCCATAATTCACTG
>probe:Drosophila_2:1623683_at:457:31; Interrogation_Position=47; Antisense; ATAATTCACTGCATTTTCCCCATTT
>probe:Drosophila_2:1623683_at:707:343; Interrogation_Position=57; Antisense; GCATTTTCCCCATTTACCGAATCAA
>probe:Drosophila_2:1623683_at:133:51; Interrogation_Position=83; Antisense; ATGCGTCTAACTAACGTTTTGTTCA

Paste this into a BLAST search page for me
GAAGAGCAAGCGCATCATGGTCGTAAAGCGCATCATGGTCGTACTGGAAAGTGTGGTCAGTGGACATCAGTTTAAAGTTTAATGCTTTTCGCGATCGCTTTTGCACAATAATTTCAGCGGCATATGATCGCTTGGCCGACAAATTGGAGAATTGGAGATAATACGCTTCGATCCGGCTTCGATCCGTACATTCAACAGGACAGGAAAGCCTTTATCGTGAACGCATCCGCAGCGCCTAAGATAACCATTTAGCGGCATATTTCCATAATTCACTGATAATTCACTGCATTTTCCCCATTTGCATTTTCCCCATTTACCGAATCAAATGCGTCTAACTAACGTTTTGTTCA

Full Affymetrix probeset data:

Annotations for 1623683_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720