FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623685_at:

>probe:Drosophila_2:1623685_at:576:103; Interrogation_Position=1496; Antisense; AGACCATACGGAAGCTGCAGCGGGA
>probe:Drosophila_2:1623685_at:128:29; Interrogation_Position=1565; Antisense; ATCTAAGGTCCCAGGCTAGCGGCGG
>probe:Drosophila_2:1623685_at:518:89; Interrogation_Position=1663; Antisense; AGTCAGGCTCTGAAGGAGGCCCAAA
>probe:Drosophila_2:1623685_at:521:437; Interrogation_Position=1678; Antisense; GAGGCCCAAAACAAGTACCGTCTGC
>probe:Drosophila_2:1623685_at:551:671; Interrogation_Position=1693; Antisense; TACCGTCTGCTGGAGGCCGACTATA
>probe:Drosophila_2:1623685_at:659:191; Interrogation_Position=1719; Antisense; AACTCTTCATGACAAGCGGCTGCAG
>probe:Drosophila_2:1623685_at:682:613; Interrogation_Position=1748; Antisense; TGAAGACCCTGCAGAGTGCCCACGA
>probe:Drosophila_2:1623685_at:598:1; Interrogation_Position=1769; Antisense; ACGAAAGGGAACTGGCCTCCTGCAA
>probe:Drosophila_2:1623685_at:280:425; Interrogation_Position=1795; Antisense; GAGACCGTGCGTATACTGCAGCAGC
>probe:Drosophila_2:1623685_at:615:547; Interrogation_Position=1833; Antisense; GGAGGAGGCACTGACCACCCAGAAG
>probe:Drosophila_2:1623685_at:368:221; Interrogation_Position=1864; Antisense; AAGGTGCCCGTGGATTACTATGCCC
>probe:Drosophila_2:1623685_at:523:273; Interrogation_Position=1942; Antisense; CTTCATATGCTGGTGGAGGCACTCA
>probe:Drosophila_2:1623685_at:212:73; Interrogation_Position=1958; Antisense; AGGCACTCAGCAAGGGACGGCTCAA
>probe:Drosophila_2:1623685_at:284:141; Interrogation_Position=1974; Antisense; ACGGCTCAACGGTGCTCTCGAGGAT

Paste this into a BLAST search page for me
AGACCATACGGAAGCTGCAGCGGGAATCTAAGGTCCCAGGCTAGCGGCGGAGTCAGGCTCTGAAGGAGGCCCAAAGAGGCCCAAAACAAGTACCGTCTGCTACCGTCTGCTGGAGGCCGACTATAAACTCTTCATGACAAGCGGCTGCAGTGAAGACCCTGCAGAGTGCCCACGAACGAAAGGGAACTGGCCTCCTGCAAGAGACCGTGCGTATACTGCAGCAGCGGAGGAGGCACTGACCACCCAGAAGAAGGTGCCCGTGGATTACTATGCCCCTTCATATGCTGGTGGAGGCACTCAAGGCACTCAGCAAGGGACGGCTCAAACGGCTCAACGGTGCTCTCGAGGAT

Full Affymetrix probeset data:

Annotations for 1623685_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720