FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623686_at:

>probe:Drosophila_2:1623686_at:206:609; Interrogation_Position=1015; Antisense; TGAGAAGCTGCCCATCTGGACGCAT
>probe:Drosophila_2:1623686_at:547:205; Interrogation_Position=1049; Antisense; AAGCGCCTGGCCATTTGCAGCTGGA
>probe:Drosophila_2:1623686_at:70:557; Interrogation_Position=1071; Antisense; GGACTCATTCGGCAGACTACCTAAA
>probe:Drosophila_2:1623686_at:592:281; Interrogation_Position=1129; Antisense; CTGCGTGCGCAACTGGAATGACCTA
>probe:Drosophila_2:1623686_at:138:57; Interrogation_Position=1146; Antisense; ATGACCTAAGCGACGAAATCCTCTT
>probe:Drosophila_2:1623686_at:279:409; Interrogation_Position=1194; Antisense; GATTGGAACACCTCGACGTGTCCTA
>probe:Drosophila_2:1623686_at:646:407; Interrogation_Position=1208; Antisense; GACGTGTCCTACTGCCGAAATCTGA
>probe:Drosophila_2:1623686_at:79:239; Interrogation_Position=1226; Antisense; AATCTGACGCCAACATTTTTGCCAC
>probe:Drosophila_2:1623686_at:5:629; Interrogation_Position=1245; Antisense; TGCCACGGGCCTTGAGTATTCTTAA
>probe:Drosophila_2:1623686_at:628:405; Interrogation_Position=1294; Antisense; GACGGGAGTTGGACGTTCGCCACCT
>probe:Drosophila_2:1623686_at:531:377; Interrogation_Position=1321; Antisense; GAAGCTCTACTACGACCTAAGTGGC
>probe:Drosophila_2:1623686_at:519:435; Interrogation_Position=1395; Antisense; GAGGATATATTGTCTTCACCGCCGA
>probe:Drosophila_2:1623686_at:219:417; Interrogation_Position=1447; Antisense; GAGCTTTGTGGACCGCGGATACCAA
>probe:Drosophila_2:1623686_at:619:553; Interrogation_Position=979; Antisense; GGACGGGTACTATATGCCCCTTGAA

Paste this into a BLAST search page for me
TGAGAAGCTGCCCATCTGGACGCATAAGCGCCTGGCCATTTGCAGCTGGAGGACTCATTCGGCAGACTACCTAAACTGCGTGCGCAACTGGAATGACCTAATGACCTAAGCGACGAAATCCTCTTGATTGGAACACCTCGACGTGTCCTAGACGTGTCCTACTGCCGAAATCTGAAATCTGACGCCAACATTTTTGCCACTGCCACGGGCCTTGAGTATTCTTAAGACGGGAGTTGGACGTTCGCCACCTGAAGCTCTACTACGACCTAAGTGGCGAGGATATATTGTCTTCACCGCCGAGAGCTTTGTGGACCGCGGATACCAAGGACGGGTACTATATGCCCCTTGAA

Full Affymetrix probeset data:

Annotations for 1623686_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720