FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623687_at:

>probe:Drosophila_2:1623687_at:302:583; Interrogation_Position=125; Antisense; TGGCGGAGCACTGCCTCTACGAGGA
>probe:Drosophila_2:1623687_at:420:671; Interrogation_Position=142; Antisense; TACGAGGAGTTGGACCTGGCCGTTC
>probe:Drosophila_2:1623687_at:719:503; Interrogation_Position=15; Antisense; GTCCGGAGCAGCTTGGATGTCCCTA
>probe:Drosophila_2:1623687_at:676:469; Interrogation_Position=163; Antisense; GTTCCACTCAATGGCTACGTTCTGC
>probe:Drosophila_2:1623687_at:549:81; Interrogation_Position=200; Antisense; AGGGCTACTGCATTCGCTTGGAGTG
>probe:Drosophila_2:1623687_at:114:343; Interrogation_Position=215; Antisense; GCTTGGAGTGCACCGATGACTATCT
>probe:Drosophila_2:1623687_at:63:405; Interrogation_Position=232; Antisense; GACTATCTGCTGTTGATACGCCACT
>probe:Drosophila_2:1623687_at:158:673; Interrogation_Position=248; Antisense; TACGCCACTGCGACAAACAGCCATG
>probe:Drosophila_2:1623687_at:323:131; Interrogation_Position=290; Antisense; ACCTCTCACCCAACGACTATGATTT
>probe:Drosophila_2:1623687_at:84:443; Interrogation_Position=30; Antisense; GATGTCCCTAGCTTTTGTGGCCTGT
>probe:Drosophila_2:1623687_at:268:403; Interrogation_Position=304; Antisense; GACTATGATTTCAAGTTCCCCGAGT
>probe:Drosophila_2:1623687_at:139:433; Interrogation_Position=325; Antisense; GAGTGCTGTCCCCAACTCGAGTGCT
>probe:Drosophila_2:1623687_at:558:517; Interrogation_Position=70; Antisense; GTGGACGGCAATGGGTTCAGCACCC
>probe:Drosophila_2:1623687_at:350:711; Interrogation_Position=85; Antisense; TTCAGCACCCAGTATCGTGGTCACA

Paste this into a BLAST search page for me
TGGCGGAGCACTGCCTCTACGAGGATACGAGGAGTTGGACCTGGCCGTTCGTCCGGAGCAGCTTGGATGTCCCTAGTTCCACTCAATGGCTACGTTCTGCAGGGCTACTGCATTCGCTTGGAGTGGCTTGGAGTGCACCGATGACTATCTGACTATCTGCTGTTGATACGCCACTTACGCCACTGCGACAAACAGCCATGACCTCTCACCCAACGACTATGATTTGATGTCCCTAGCTTTTGTGGCCTGTGACTATGATTTCAAGTTCCCCGAGTGAGTGCTGTCCCCAACTCGAGTGCTGTGGACGGCAATGGGTTCAGCACCCTTCAGCACCCAGTATCGTGGTCACA

Full Affymetrix probeset data:

Annotations for 1623687_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720