Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623688_at:

>probe:Drosophila_2:1623688_at:178:665; Interrogation_Position=2412; Antisense; TAAATGCTATCTACGCACTCTGGCC
>probe:Drosophila_2:1623688_at:113:661; Interrogation_Position=2445; Antisense; TAAACCCTTGGTGGCTGGCATTGTT
>probe:Drosophila_2:1623688_at:717:243; Interrogation_Position=2482; Antisense; AATTTGGGCGTTATGCAGCTTCCCT
>probe:Drosophila_2:1623688_at:533:693; Interrogation_Position=2506; Antisense; TTTGCTGACTACGTGGTGGCCTCTG
>probe:Drosophila_2:1623688_at:243:523; Interrogation_Position=2521; Antisense; GTGGCCTCTGATGATTGTAGCTTCG
>probe:Drosophila_2:1623688_at:292:487; Interrogation_Position=2537; Antisense; GTAGCTTCGAGACTAACTATGCCAA
>probe:Drosophila_2:1623688_at:315:49; Interrogation_Position=2555; Antisense; ATGCCAAATTGGGTCAGCTGCCCGA
>probe:Drosophila_2:1623688_at:126:683; Interrogation_Position=2584; Antisense; TATGCTCTGTGGCATGGTCACCAAA
>probe:Drosophila_2:1623688_at:215:695; Interrogation_Position=2612; Antisense; TTTCCAGTGAAGTGCACTCGCGTTT
>probe:Drosophila_2:1623688_at:277:145; Interrogation_Position=2627; Antisense; ACTCGCGTTTGTTTCTTATGGGTGA
>probe:Drosophila_2:1623688_at:233:231; Interrogation_Position=2716; Antisense; AATGTCAACGAAATGGCTCTGGCCA
>probe:Drosophila_2:1623688_at:657:457; Interrogation_Position=2751; Antisense; GATATCCACTAGCTCTGCGGAGATG
>probe:Drosophila_2:1623688_at:319:295; Interrogation_Position=2819; Antisense; CGAAATTCCCGCGTCTGGATGAGGA
>probe:Drosophila_2:1623688_at:207:531; Interrogation_Position=2867; Antisense; GGGTTACTGCCGATTGCTTAGCCAA

Paste this into a BLAST search page for me
TAAATGCTATCTACGCACTCTGGCCTAAACCCTTGGTGGCTGGCATTGTTAATTTGGGCGTTATGCAGCTTCCCTTTTGCTGACTACGTGGTGGCCTCTGGTGGCCTCTGATGATTGTAGCTTCGGTAGCTTCGAGACTAACTATGCCAAATGCCAAATTGGGTCAGCTGCCCGATATGCTCTGTGGCATGGTCACCAAATTTCCAGTGAAGTGCACTCGCGTTTACTCGCGTTTGTTTCTTATGGGTGAAATGTCAACGAAATGGCTCTGGCCAGATATCCACTAGCTCTGCGGAGATGCGAAATTCCCGCGTCTGGATGAGGAGGGTTACTGCCGATTGCTTAGCCAA

Full Affymetrix probeset data:

Annotations for 1623688_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime