FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623690_at:

>probe:Drosophila_2:1623690_at:278:389; Interrogation_Position=257; Antisense; GAAACATGAGTCTGGAGCTGTCCCT
>probe:Drosophila_2:1623690_at:360:137; Interrogation_Position=290; Antisense; ACGACGATCCGGTCAGCGAGCGAAA
>probe:Drosophila_2:1623690_at:615:267; Interrogation_Position=352; Antisense; CATGAGGGCTTCACCGAAACTGCGG
>probe:Drosophila_2:1623690_at:128:707; Interrogation_Position=392; Antisense; TTAAGCTAAATATTCCGGTCCTGGA
>probe:Drosophila_2:1623690_at:253:631; Interrogation_Position=410; Antisense; TCCTGGAGCCGGTGAAGCACCTGAT
>probe:Drosophila_2:1623690_at:230:573; Interrogation_Position=454; Antisense; GGCGTGAACGACTCCCATGTGAAGA
>probe:Drosophila_2:1623690_at:371:669; Interrogation_Position=483; Antisense; TACTCATCGGCTGATTGGACACCAT
>probe:Drosophila_2:1623690_at:619:451; Interrogation_Position=571; Antisense; GATCGGGAGACAGCCATCGACAGCA
>probe:Drosophila_2:1623690_at:497:197; Interrogation_Position=633; Antisense; AACGGTTCTGTTCAGCATCTTGCAG
>probe:Drosophila_2:1623690_at:574:237; Interrogation_Position=658; Antisense; AATCTTCGCAAGGTGTTTGCCGCTA
>probe:Drosophila_2:1623690_at:586:319; Interrogation_Position=676; Antisense; GCCGCTAGCGCTGGAAGTGCAAGTT
>probe:Drosophila_2:1623690_at:193:373; Interrogation_Position=689; Antisense; GAAGTGCAAGTTCCGCATCCTCGGG
>probe:Drosophila_2:1623690_at:704:177; Interrogation_Position=732; Antisense; AAACTAGTGGACTTTCTCGGAGATT
>probe:Drosophila_2:1623690_at:304:11; Interrogation_Position=788; Antisense; ATTCGGATTTCCCTTGATTCTTACT

Paste this into a BLAST search page for me
GAAACATGAGTCTGGAGCTGTCCCTACGACGATCCGGTCAGCGAGCGAAACATGAGGGCTTCACCGAAACTGCGGTTAAGCTAAATATTCCGGTCCTGGATCCTGGAGCCGGTGAAGCACCTGATGGCGTGAACGACTCCCATGTGAAGATACTCATCGGCTGATTGGACACCATGATCGGGAGACAGCCATCGACAGCAAACGGTTCTGTTCAGCATCTTGCAGAATCTTCGCAAGGTGTTTGCCGCTAGCCGCTAGCGCTGGAAGTGCAAGTTGAAGTGCAAGTTCCGCATCCTCGGGAAACTAGTGGACTTTCTCGGAGATTATTCGGATTTCCCTTGATTCTTACT

Full Affymetrix probeset data:

Annotations for 1623690_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720