Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623691_at:

>probe:Drosophila_2:1623691_at:630:299; Interrogation_Position=2984; Antisense; CCGCCATGGAAAAGGTGAACGATCA
>probe:Drosophila_2:1623691_at:210:81; Interrogation_Position=2996; Antisense; AGGTGAACGATCAATTCAATTCAAT
>probe:Drosophila_2:1623691_at:680:719; Interrogation_Position=3032; Antisense; TTCCGTACCGCTTCTGTAGTCCATT
>probe:Drosophila_2:1623691_at:658:487; Interrogation_Position=3036; Antisense; GTACCGCTTCTGTAGTCCATTTTCA
>probe:Drosophila_2:1623691_at:128:673; Interrogation_Position=3037; Antisense; TACCGCTTCTGTAGTCCATTTTCAA
>probe:Drosophila_2:1623691_at:190:301; Interrogation_Position=3039; Antisense; CCGCTTCTGTAGTCCATTTTCAAGT
>probe:Drosophila_2:1623691_at:649:337; Interrogation_Position=3041; Antisense; GCTTCTGTAGTCCATTTTCAAGTCA
>probe:Drosophila_2:1623691_at:53:715; Interrogation_Position=3043; Antisense; TTCTGTAGTCCATTTTCAAGTCATA
>probe:Drosophila_2:1623691_at:179:285; Interrogation_Position=3045; Antisense; CTGTAGTCCATTTTCAAGTCATATT
>probe:Drosophila_2:1623691_at:618:483; Interrogation_Position=3047; Antisense; GTAGTCCATTTTCAAGTCATATTTC
>probe:Drosophila_2:1623691_at:308:505; Interrogation_Position=3050; Antisense; GTCCATTTTCAAGTCATATTTCTTA
>probe:Drosophila_2:1623691_at:336:219; Interrogation_Position=3060; Antisense; AAGTCATATTTCTTATCTAGGAACC
>probe:Drosophila_2:1623691_at:553:495; Interrogation_Position=3062; Antisense; GTCATATTTCTTATCTAGGAACCAA
>probe:Drosophila_2:1623691_at:618:695; Interrogation_Position=3068; Antisense; TTTCTTATCTAGGAACCAAATGTTG

Paste this into a BLAST search page for me
CCGCCATGGAAAAGGTGAACGATCAAGGTGAACGATCAATTCAATTCAATTTCCGTACCGCTTCTGTAGTCCATTGTACCGCTTCTGTAGTCCATTTTCATACCGCTTCTGTAGTCCATTTTCAACCGCTTCTGTAGTCCATTTTCAAGTGCTTCTGTAGTCCATTTTCAAGTCATTCTGTAGTCCATTTTCAAGTCATACTGTAGTCCATTTTCAAGTCATATTGTAGTCCATTTTCAAGTCATATTTCGTCCATTTTCAAGTCATATTTCTTAAAGTCATATTTCTTATCTAGGAACCGTCATATTTCTTATCTAGGAACCAATTTCTTATCTAGGAACCAAATGTTG

Full Affymetrix probeset data:

Annotations for 1623691_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime