FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623694_at:

>probe:Drosophila_2:1623694_at:501:309; Interrogation_Position=1668; Antisense; CCACTGACGAGTTGGGCTTCAAGCC
>probe:Drosophila_2:1623694_at:685:521; Interrogation_Position=1681; Antisense; GGGCTTCAAGCCCATCAGGAATCGG
>probe:Drosophila_2:1623694_at:495:35; Interrogation_Position=1694; Antisense; ATCAGGAATCGGGACCAACAGCAGC
>probe:Drosophila_2:1623694_at:246:255; Interrogation_Position=1709; Antisense; CAACAGCAGCTGTACGTGTGCGGTC
>probe:Drosophila_2:1623694_at:271:517; Interrogation_Position=1724; Antisense; GTGTGCGGTCCTGCGGGAATAATCA
>probe:Drosophila_2:1623694_at:437:619; Interrogation_Position=1746; Antisense; TCACCGAGAATAAGTAGGACCTGCT
>probe:Drosophila_2:1623694_at:61:185; Interrogation_Position=1775; Antisense; AAAAGTCATATTCACAAGTCGGATT
>probe:Drosophila_2:1623694_at:480:225; Interrogation_Position=1972; Antisense; AAGGCATAATGGAACGCACTTTACT
>probe:Drosophila_2:1623694_at:37:561; Interrogation_Position=1982; Antisense; GGAACGCACTTTACTTGGTGATCAT
>probe:Drosophila_2:1623694_at:672:21; Interrogation_Position=2013; Antisense; ATATACTCTACAACGCAAATGGAGA
>probe:Drosophila_2:1623694_at:208:165; Interrogation_Position=2113; Antisense; AAATCCCACCTTGGTAGGCGCAGAA
>probe:Drosophila_2:1623694_at:203:603; Interrogation_Position=2147; Antisense; TGTTAGTGCTGCTTGGTTTCTTTAA
>probe:Drosophila_2:1623694_at:191:703; Interrogation_Position=2176; Antisense; TTATTCATTCTGTGCCTATCTGGAG
>probe:Drosophila_2:1623694_at:687:641; Interrogation_Position=2184; Antisense; TCTGTGCCTATCTGGAGTGTATTAT

Paste this into a BLAST search page for me
CCACTGACGAGTTGGGCTTCAAGCCGGGCTTCAAGCCCATCAGGAATCGGATCAGGAATCGGGACCAACAGCAGCCAACAGCAGCTGTACGTGTGCGGTCGTGTGCGGTCCTGCGGGAATAATCATCACCGAGAATAAGTAGGACCTGCTAAAAGTCATATTCACAAGTCGGATTAAGGCATAATGGAACGCACTTTACTGGAACGCACTTTACTTGGTGATCATATATACTCTACAACGCAAATGGAGAAAATCCCACCTTGGTAGGCGCAGAATGTTAGTGCTGCTTGGTTTCTTTAATTATTCATTCTGTGCCTATCTGGAGTCTGTGCCTATCTGGAGTGTATTAT

Full Affymetrix probeset data:

Annotations for 1623694_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720