Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623696_at:

>probe:Drosophila_2:1623696_at:48:107; Interrogation_Position=1018; Antisense; AGAACTGGAGAAGCACCCCGATCAC
>probe:Drosophila_2:1623696_at:684:713; Interrogation_Position=1061; Antisense; TTCTCGCGAACCAGCTTGTATCAGA
>probe:Drosophila_2:1623696_at:567:353; Interrogation_Position=1093; Antisense; GCAGCGGGACACTACTGGAGAGCAC
>probe:Drosophila_2:1623696_at:74:525; Interrogation_Position=1162; Antisense; GGGCGAGGCCCAAATGATCATAGAT
>probe:Drosophila_2:1623696_at:345:57; Interrogation_Position=1175; Antisense; ATGATCATAGATGCCTTCGACATGG
>probe:Drosophila_2:1623696_at:162:367; Interrogation_Position=1216; Antisense; GAATCTGCAGAGTCGTTTGTCCGGA
>probe:Drosophila_2:1623696_at:228:537; Interrogation_Position=1261; Antisense; GGTCACATCCGGAGACGAACTTCAT
>probe:Drosophila_2:1623696_at:167:467; Interrogation_Position=1288; Antisense; GTTGGCAAACACATCACATTTTCTT
>probe:Drosophila_2:1623696_at:211:225; Interrogation_Position=869; Antisense; AAGGACGTTATTGCCTACATGCAAC
>probe:Drosophila_2:1623696_at:225:151; Interrogation_Position=885; Antisense; ACATGCAACTTCCTGGTAGCGACAT
>probe:Drosophila_2:1623696_at:22:401; Interrogation_Position=905; Antisense; GACATCGTCCTCCAGGCGGTGGTCA
>probe:Drosophila_2:1623696_at:377:591; Interrogation_Position=924; Antisense; TGGTCATCAGCTATGGCCAGGACAA
>probe:Drosophila_2:1623696_at:397:427; Interrogation_Position=974; Antisense; GAGTTGCAACGATTCTCTTTTGATA
>probe:Drosophila_2:1623696_at:380:693; Interrogation_Position=992; Antisense; TTTGATATTGACTTTCCACTGCCCG

Paste this into a BLAST search page for me
AGAACTGGAGAAGCACCCCGATCACTTCTCGCGAACCAGCTTGTATCAGAGCAGCGGGACACTACTGGAGAGCACGGGCGAGGCCCAAATGATCATAGATATGATCATAGATGCCTTCGACATGGGAATCTGCAGAGTCGTTTGTCCGGAGGTCACATCCGGAGACGAACTTCATGTTGGCAAACACATCACATTTTCTTAAGGACGTTATTGCCTACATGCAACACATGCAACTTCCTGGTAGCGACATGACATCGTCCTCCAGGCGGTGGTCATGGTCATCAGCTATGGCCAGGACAAGAGTTGCAACGATTCTCTTTTGATATTTGATATTGACTTTCCACTGCCCG

Full Affymetrix probeset data:

Annotations for 1623696_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime