Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623697_s_at:

>probe:Drosophila_2:1623697_s_at:434:725; Interrogation_Position=1029; Antisense; TTGTGTCGCACAACCTATTGATTTT
>probe:Drosophila_2:1623697_s_at:194:17; Interrogation_Position=1049; Antisense; ATTTTAAAGTTCAAGCGCCAGGCTC
>probe:Drosophila_2:1623697_s_at:121:539; Interrogation_Position=1112; Antisense; GGTACTATCTTTTTGGCCTAATGAG
>probe:Drosophila_2:1623697_s_at:481:407; Interrogation_Position=1147; Antisense; GACGGCATGGTGGTCTACACCTATA
>probe:Drosophila_2:1623697_s_at:419:317; Interrogation_Position=623; Antisense; GCCTGTGGGAGGTATCTCTGCATCA
>probe:Drosophila_2:1623697_s_at:398:109; Interrogation_Position=647; Antisense; AGAATACTTTCTCTGGCGTGCTTAT
>probe:Drosophila_2:1623697_s_at:400:677; Interrogation_Position=678; Antisense; TAGATTTGTCTTGACGGTGGCCAGT
>probe:Drosophila_2:1623697_s_at:353:71; Interrogation_Position=700; Antisense; AGTGCTTTCCCTAACATTCCTTTAG
>probe:Drosophila_2:1623697_s_at:659:43; Interrogation_Position=782; Antisense; ATCCCAGATTCACGCATTCATCAAT
>probe:Drosophila_2:1623697_s_at:44:341; Interrogation_Position=825; Antisense; GCTTAAACTAGCTCACGATGTGCCA
>probe:Drosophila_2:1623697_s_at:4:443; Interrogation_Position=841; Antisense; GATGTGCCAAACTCAGATCTTGTCA
>probe:Drosophila_2:1623697_s_at:162:495; Interrogation_Position=862; Antisense; GTCAAGCCAATCTGCATTGTCCCAA
>probe:Drosophila_2:1623697_s_at:51:599; Interrogation_Position=879; Antisense; TGTCCCAAGTCCCAAATTGCCAAGG
>probe:Drosophila_2:1623697_s_at:559:71; Interrogation_Position=952; Antisense; AGGAATGTTACTTTGAACGCCATCA

Paste this into a BLAST search page for me
TTGTGTCGCACAACCTATTGATTTTATTTTAAAGTTCAAGCGCCAGGCTCGGTACTATCTTTTTGGCCTAATGAGGACGGCATGGTGGTCTACACCTATAGCCTGTGGGAGGTATCTCTGCATCAAGAATACTTTCTCTGGCGTGCTTATTAGATTTGTCTTGACGGTGGCCAGTAGTGCTTTCCCTAACATTCCTTTAGATCCCAGATTCACGCATTCATCAATGCTTAAACTAGCTCACGATGTGCCAGATGTGCCAAACTCAGATCTTGTCAGTCAAGCCAATCTGCATTGTCCCAATGTCCCAAGTCCCAAATTGCCAAGGAGGAATGTTACTTTGAACGCCATCA

Full Affymetrix probeset data:

Annotations for 1623697_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime