FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623700_at:

>probe:Drosophila_2:1623700_at:278:189; Interrogation_Position=175; Antisense; AACAGAGCAGGACGTTGGCACCAGG
>probe:Drosophila_2:1623700_at:445:347; Interrogation_Position=181; Antisense; GCAGGACGTTGGCACCAGGGTGCTA
>probe:Drosophila_2:1623700_at:528:129; Interrogation_Position=194; Antisense; ACCAGGGTGCTAGGCAGCTGCGGCA
>probe:Drosophila_2:1623700_at:10:201; Interrogation_Position=421; Antisense; AACCCACCTGAGCACTGGACTTTGT
>probe:Drosophila_2:1623700_at:429:309; Interrogation_Position=424; Antisense; CCACCTGAGCACTGGACTTTGTCCA
>probe:Drosophila_2:1623700_at:244:305; Interrogation_Position=427; Antisense; CCTGAGCACTGGACTTTGTCCAGGT
>probe:Drosophila_2:1623700_at:585:509; Interrogation_Position=437; Antisense; GGACTTTGTCCAGGTCGAAGGGTAT
>probe:Drosophila_2:1623700_at:547:145; Interrogation_Position=439; Antisense; ACTTTGTCCAGGTCGAAGGGTATGC
>probe:Drosophila_2:1623700_at:29:725; Interrogation_Position=442; Antisense; TTGTCCAGGTCGAAGGGTATGCAGA
>probe:Drosophila_2:1623700_at:422:499; Interrogation_Position=450; Antisense; GTCGAAGGGTATGCAGACGGGCCTC
>probe:Drosophila_2:1623700_at:168:295; Interrogation_Position=492; Antisense; CGATGATTTCGAAACGCACAACTGT
>probe:Drosophila_2:1623700_at:611:457; Interrogation_Position=496; Antisense; GATTTCGAAACGCACAACTGTTGCT
>probe:Drosophila_2:1623700_at:134:545; Interrogation_Position=577; Antisense; GGATCTACGGCTGGATCTGAATATG
>probe:Drosophila_2:1623700_at:104:279; Interrogation_Position=581; Antisense; CTACGGCTGGATCTGAATATGAATG

Paste this into a BLAST search page for me
AACAGAGCAGGACGTTGGCACCAGGGCAGGACGTTGGCACCAGGGTGCTAACCAGGGTGCTAGGCAGCTGCGGCAAACCCACCTGAGCACTGGACTTTGTCCACCTGAGCACTGGACTTTGTCCACCTGAGCACTGGACTTTGTCCAGGTGGACTTTGTCCAGGTCGAAGGGTATACTTTGTCCAGGTCGAAGGGTATGCTTGTCCAGGTCGAAGGGTATGCAGAGTCGAAGGGTATGCAGACGGGCCTCCGATGATTTCGAAACGCACAACTGTGATTTCGAAACGCACAACTGTTGCTGGATCTACGGCTGGATCTGAATATGCTACGGCTGGATCTGAATATGAATG

Full Affymetrix probeset data:

Annotations for 1623700_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720