Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623701_at:

>probe:Drosophila_2:1623701_at:620:641; Interrogation_Position=1008; Antisense; TCTTCAGGAGCGTGCCAAGGGTCTA
>probe:Drosophila_2:1623701_at:131:207; Interrogation_Position=1141; Antisense; AAGCGAGAGGTTACGCAGCCGCCAT
>probe:Drosophila_2:1623701_at:533:353; Interrogation_Position=1174; Antisense; GCAGCCCAGAAGTCGTCCAAGCAAT
>probe:Drosophila_2:1623701_at:428:133; Interrogation_Position=1236; Antisense; ACCCAAGTCTACATACGCGGACGAA
>probe:Drosophila_2:1623701_at:386:189; Interrogation_Position=1259; Antisense; AACAGGACACGACTCTTGCCAAGGT
>probe:Drosophila_2:1623701_at:199:341; Interrogation_Position=1298; Antisense; GCTACGTTTTGGAGCTCTTGGCTAA
>probe:Drosophila_2:1623701_at:461:661; Interrogation_Position=1320; Antisense; TAAACTGGACCACATCGAACCGAGC
>probe:Drosophila_2:1623701_at:145:113; Interrogation_Position=1364; Antisense; AGCAGGTTCGACGTCGCATGGCAGC
>probe:Drosophila_2:1623701_at:103:341; Interrogation_Position=1392; Antisense; GAAGGAAATGTCTCGCCGTGCGTTA
>probe:Drosophila_2:1623701_at:126:327; Interrogation_Position=1411; Antisense; GCGTTAGTCAAGCAGAACCGGCTAC
>probe:Drosophila_2:1623701_at:534:571; Interrogation_Position=1430; Antisense; GGCTACACAACTGGATGGCGCATTT
>probe:Drosophila_2:1623701_at:455:611; Interrogation_Position=921; Antisense; TGACAAGGCCCAGAAGACGTACGAG
>probe:Drosophila_2:1623701_at:720:487; Interrogation_Position=939; Antisense; GTACGAGCGTCAGGTGAAAGCCAAT
>probe:Drosophila_2:1623701_at:609:391; Interrogation_Position=954; Antisense; GAAAGCCAATGTGTTCCTCAAGGAT

Paste this into a BLAST search page for me
TCTTCAGGAGCGTGCCAAGGGTCTAAAGCGAGAGGTTACGCAGCCGCCATGCAGCCCAGAAGTCGTCCAAGCAATACCCAAGTCTACATACGCGGACGAAAACAGGACACGACTCTTGCCAAGGTGCTACGTTTTGGAGCTCTTGGCTAATAAACTGGACCACATCGAACCGAGCAGCAGGTTCGACGTCGCATGGCAGCGAAGGAAATGTCTCGCCGTGCGTTAGCGTTAGTCAAGCAGAACCGGCTACGGCTACACAACTGGATGGCGCATTTTGACAAGGCCCAGAAGACGTACGAGGTACGAGCGTCAGGTGAAAGCCAATGAAAGCCAATGTGTTCCTCAAGGAT

Full Affymetrix probeset data:

Annotations for 1623701_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime