Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623702_at:

>probe:Drosophila_2:1623702_at:592:123; Interrogation_Position=264; Antisense; AGCGCCAAGTTCGTGAAGCTCTTCA
>probe:Drosophila_2:1623702_at:604:207; Interrogation_Position=279; Antisense; AAGCTCTTCATCACCTTGAACGGAG
>probe:Drosophila_2:1623702_at:634:629; Interrogation_Position=361; Antisense; TCCATGTGCGCGATCTTCAGGGCAA
>probe:Drosophila_2:1623702_at:402:563; Interrogation_Position=381; Antisense; GGCAAGGACTTTGGGCTGACCGTAA
>probe:Drosophila_2:1623702_at:559:283; Interrogation_Position=396; Antisense; CTGACCGTAAACAATCTGCTGCACA
>probe:Drosophila_2:1623702_at:263:97; Interrogation_Position=448; Antisense; AGATCAAGACCGACATGGTGGCCAT
>probe:Drosophila_2:1623702_at:498:529; Interrogation_Position=502; Antisense; GGGATGTGCTCACCGCTATCCAGAA
>probe:Drosophila_2:1623702_at:91:99; Interrogation_Position=563; Antisense; AGATGGCGACAATCCCGAATCGGCG
>probe:Drosophila_2:1623702_at:396:367; Interrogation_Position=579; Antisense; GAATCGGCGCTTGTTAACATCATGA
>probe:Drosophila_2:1623702_at:422:197; Interrogation_Position=615; Antisense; AACGACGGTGACTCCAAGACGAAGC
>probe:Drosophila_2:1623702_at:400:443; Interrogation_Position=641; Antisense; GATGATCGCCAAAGCTTGGACCGAG
>probe:Drosophila_2:1623702_at:68:543; Interrogation_Position=705; Antisense; GGATTGGATTCTTTCGACGATCTTT
>probe:Drosophila_2:1623702_at:132:191; Interrogation_Position=767; Antisense; AACTACCTAAGGCACTGCTTCGATT
>probe:Drosophila_2:1623702_at:596:343; Interrogation_Position=783; Antisense; GCTTCGATTCCAGCACAATTTGTAT

Paste this into a BLAST search page for me
AGCGCCAAGTTCGTGAAGCTCTTCAAAGCTCTTCATCACCTTGAACGGAGTCCATGTGCGCGATCTTCAGGGCAAGGCAAGGACTTTGGGCTGACCGTAACTGACCGTAAACAATCTGCTGCACAAGATCAAGACCGACATGGTGGCCATGGGATGTGCTCACCGCTATCCAGAAAGATGGCGACAATCCCGAATCGGCGGAATCGGCGCTTGTTAACATCATGAAACGACGGTGACTCCAAGACGAAGCGATGATCGCCAAAGCTTGGACCGAGGGATTGGATTCTTTCGACGATCTTTAACTACCTAAGGCACTGCTTCGATTGCTTCGATTCCAGCACAATTTGTAT

Full Affymetrix probeset data:

Annotations for 1623702_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime