Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623704_at:

>probe:Drosophila_2:1623704_at:266:703; Interrogation_Position=1623; Antisense; TTTTGAGGCAGAGTTCCAGCCGCAT
>probe:Drosophila_2:1623704_at:633:123; Interrogation_Position=1640; Antisense; AGCCGCATCCGTTTTGCGGAGATCT
>probe:Drosophila_2:1623704_at:343:331; Interrogation_Position=1655; Antisense; GCGGAGATCTTGCTATTGTTTATAC
>probe:Drosophila_2:1623704_at:412:663; Interrogation_Position=1691; Antisense; TACAACAAGAACGACCCACTACTAA
>probe:Drosophila_2:1623704_at:132:261; Interrogation_Position=1738; Antisense; CAGAAAACCATGACGGACGGAGGAT
>probe:Drosophila_2:1623704_at:506:437; Interrogation_Position=1781; Antisense; GATGGCGACCTACAAATGAACCGAA
>probe:Drosophila_2:1623704_at:354:379; Interrogation_Position=1798; Antisense; GAACCGAAGACCATGGACAGACCCT
>probe:Drosophila_2:1623704_at:152:413; Interrogation_Position=1806; Antisense; GACCATGGACAGACCCTTAGTGTTA
>probe:Drosophila_2:1623704_at:624:341; Interrogation_Position=1949; Antisense; GCTTATTTTTTGAAGCAAGCCCCTA
>probe:Drosophila_2:1623704_at:260:359; Interrogation_Position=1963; Antisense; GCAAGCCCCTAACCATTAACGAATT
>probe:Drosophila_2:1623704_at:526:469; Interrogation_Position=1991; Antisense; GTTGCATTCAATTTCCGCTATATCC
>probe:Drosophila_2:1623704_at:572:719; Interrogation_Position=2003; Antisense; TTCCGCTATATCCACGAAATCGATG
>probe:Drosophila_2:1623704_at:404:393; Interrogation_Position=2018; Antisense; GAAATCGATGTTGTTAACCGCCCCG
>probe:Drosophila_2:1623704_at:174:527; Interrogation_Position=2056; Antisense; GGGAATGAATGCTTGTGTTAATACC

Paste this into a BLAST search page for me
TTTTGAGGCAGAGTTCCAGCCGCATAGCCGCATCCGTTTTGCGGAGATCTGCGGAGATCTTGCTATTGTTTATACTACAACAAGAACGACCCACTACTAACAGAAAACCATGACGGACGGAGGATGATGGCGACCTACAAATGAACCGAAGAACCGAAGACCATGGACAGACCCTGACCATGGACAGACCCTTAGTGTTAGCTTATTTTTTGAAGCAAGCCCCTAGCAAGCCCCTAACCATTAACGAATTGTTGCATTCAATTTCCGCTATATCCTTCCGCTATATCCACGAAATCGATGGAAATCGATGTTGTTAACCGCCCCGGGGAATGAATGCTTGTGTTAATACC

Full Affymetrix probeset data:

Annotations for 1623704_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime