FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623706_at:

>probe:Drosophila_2:1623706_at:484:615; Interrogation_Position=1014; Antisense; TGCAATTGCTGCAGGAGCGCCGCGA
>probe:Drosophila_2:1623706_at:365:533; Interrogation_Position=1051; Antisense; GGTGTACTATGCATCCTTCAAGGAT
>probe:Drosophila_2:1623706_at:238:225; Interrogation_Position=1070; Antisense; AAGGATGCTCTGGAGTACGCCCGCT
>probe:Drosophila_2:1623706_at:678:437; Interrogation_Position=1097; Antisense; GAGGACATTCCCAGCTATGAGGATC
>probe:Drosophila_2:1623706_at:663:389; Interrogation_Position=1145; Antisense; GAAACCTACGGACTTTTCGGCATGT
>probe:Drosophila_2:1623706_at:596:107; Interrogation_Position=1227; Antisense; AGAACATGCAGGACGAGGCCTTCAA
>probe:Drosophila_2:1623706_at:672:99; Interrogation_Position=1260; Antisense; AGATGGATGCCATCTTCTCGCAAAA
>probe:Drosophila_2:1623706_at:648:93; Interrogation_Position=1284; Antisense; AGTTCCTGAACGACCACCAAAAGTG
>probe:Drosophila_2:1623706_at:527:205; Interrogation_Position=1316; Antisense; AAGCGAGCTGATTCACTTGGCGTCT
>probe:Drosophila_2:1623706_at:278:229; Interrogation_Position=1397; Antisense; AATGGAGGCTCTTCCAAGGCACACA
>probe:Drosophila_2:1623706_at:365:567; Interrogation_Position=1414; Antisense; GGCACACATCCTTGATATAGCTATA
>probe:Drosophila_2:1623706_at:422:341; Interrogation_Position=1433; Antisense; GCTATATTAGCTTTCGGCCTGAGAA
>probe:Drosophila_2:1623706_at:509:721; Interrogation_Position=947; Antisense; TTCCAACTCAGCTTCTATGGCAGTC
>probe:Drosophila_2:1623706_at:491:621; Interrogation_Position=977; Antisense; TGCGATCTGAACTTCTTCCTGAACA

Paste this into a BLAST search page for me
TGCAATTGCTGCAGGAGCGCCGCGAGGTGTACTATGCATCCTTCAAGGATAAGGATGCTCTGGAGTACGCCCGCTGAGGACATTCCCAGCTATGAGGATCGAAACCTACGGACTTTTCGGCATGTAGAACATGCAGGACGAGGCCTTCAAAGATGGATGCCATCTTCTCGCAAAAAGTTCCTGAACGACCACCAAAAGTGAAGCGAGCTGATTCACTTGGCGTCTAATGGAGGCTCTTCCAAGGCACACAGGCACACATCCTTGATATAGCTATAGCTATATTAGCTTTCGGCCTGAGAATTCCAACTCAGCTTCTATGGCAGTCTGCGATCTGAACTTCTTCCTGAACA

Full Affymetrix probeset data:

Annotations for 1623706_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720