Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623707_a_at:

>probe:Drosophila_2:1623707_a_at:427:219; Interrogation_Position=125; Antisense; AAGTCGTGCGAAGAACAACCAGCAT
>probe:Drosophila_2:1623707_a_at:664:115; Interrogation_Position=145; Antisense; AGCATCATGCTGCTCGACTTTCTAT
>probe:Drosophila_2:1623707_a_at:577:335; Interrogation_Position=156; Antisense; GCTCGACTTTCTATGCATTTTTCTG
>probe:Drosophila_2:1623707_a_at:343:543; Interrogation_Position=191; Antisense; GGATTCTTTATGTTTAGCTTCTCGC
>probe:Drosophila_2:1623707_a_at:74:677; Interrogation_Position=205; Antisense; TAGCTTCTCGCTGCACAATGTAATT
>probe:Drosophila_2:1623707_a_at:517:535; Interrogation_Position=23; Antisense; GGTCGTTCAAAATTCGTGTTCACAA
>probe:Drosophila_2:1623707_a_at:549:541; Interrogation_Position=256; Antisense; GGATTGGTTTCTGCACATACATGGC
>probe:Drosophila_2:1623707_a_at:337:269; Interrogation_Position=271; Antisense; CATACATGGCACTGATTTGACGGAA
>probe:Drosophila_2:1623707_a_at:225:343; Interrogation_Position=301; Antisense; GCTTTTGATATTGTACGCTTCGGAT
>probe:Drosophila_2:1623707_a_at:304:669; Interrogation_Position=314; Antisense; TACGCTTCGGATTTAATTTTTGCCT
>probe:Drosophila_2:1623707_a_at:418:17; Interrogation_Position=329; Antisense; ATTTTTGCCTTTACGTATGTCCTCG
>probe:Drosophila_2:1623707_a_at:10:63; Interrogation_Position=345; Antisense; ATGTCCTCGCAGGAGTTTTGCTAGC
>probe:Drosophila_2:1623707_a_at:354:453; Interrogation_Position=406; Antisense; GATCTTAAGCTATTTCTTTCCCATA
>probe:Drosophila_2:1623707_a_at:125:689; Interrogation_Position=97; Antisense; TATTTAAACCAGCTTCACGATGTGT

Paste this into a BLAST search page for me
AAGTCGTGCGAAGAACAACCAGCATAGCATCATGCTGCTCGACTTTCTATGCTCGACTTTCTATGCATTTTTCTGGGATTCTTTATGTTTAGCTTCTCGCTAGCTTCTCGCTGCACAATGTAATTGGTCGTTCAAAATTCGTGTTCACAAGGATTGGTTTCTGCACATACATGGCCATACATGGCACTGATTTGACGGAAGCTTTTGATATTGTACGCTTCGGATTACGCTTCGGATTTAATTTTTGCCTATTTTTGCCTTTACGTATGTCCTCGATGTCCTCGCAGGAGTTTTGCTAGCGATCTTAAGCTATTTCTTTCCCATATATTTAAACCAGCTTCACGATGTGT

Full Affymetrix probeset data:

Annotations for 1623707_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime