Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623708_at:

>probe:Drosophila_2:1623708_at:170:29; Interrogation_Position=1652; Antisense; ATACTCTAAATAGTCCAACGCATTA
>probe:Drosophila_2:1623708_at:332:23; Interrogation_Position=1880; Antisense; ATAGTTTGTACGAAGCAGTCCTAAA
>probe:Drosophila_2:1623708_at:129:343; Interrogation_Position=1894; Antisense; GCAGTCCTAAACACAACAATACGAA
>probe:Drosophila_2:1623708_at:11:311; Interrogation_Position=1922; Antisense; CCACGCCCACACAACTTTAAGATAT
>probe:Drosophila_2:1623708_at:587:385; Interrogation_Position=1959; Antisense; GAACAGAGCGTACCTGAGCAGACCT
>probe:Drosophila_2:1623708_at:538:609; Interrogation_Position=1973; Antisense; TGAGCAGACCTCAGAGACTCGGAAT
>probe:Drosophila_2:1623708_at:287:583; Interrogation_Position=2015; Antisense; TGGCTAAAAGCCAGCACCAGGACCA
>probe:Drosophila_2:1623708_at:234:129; Interrogation_Position=2030; Antisense; ACCAGGACCACACCGAACAGATTAC
>probe:Drosophila_2:1623708_at:698:295; Interrogation_Position=2043; Antisense; CGAACAGATTACTCCGATCGGATCC
>probe:Drosophila_2:1623708_at:337:449; Interrogation_Position=2058; Antisense; GATCGGATCCCTCTGAAGGACCCAT
>probe:Drosophila_2:1623708_at:421:555; Interrogation_Position=2075; Antisense; GGACCCATCCATCTATGTGAACGTT
>probe:Drosophila_2:1623708_at:665:381; Interrogation_Position=2093; Antisense; GAACGTTGTAAACCCTCTGTGTGTC
>probe:Drosophila_2:1623708_at:486:595; Interrogation_Position=2110; Antisense; TGTGTGTCCTTTCGTTCCGTCACTT
>probe:Drosophila_2:1623708_at:463:643; Interrogation_Position=2134; Antisense; TCTCCTCATCAATCAGCTATCAGCA

Paste this into a BLAST search page for me
ATACTCTAAATAGTCCAACGCATTAATAGTTTGTACGAAGCAGTCCTAAAGCAGTCCTAAACACAACAATACGAACCACGCCCACACAACTTTAAGATATGAACAGAGCGTACCTGAGCAGACCTTGAGCAGACCTCAGAGACTCGGAATTGGCTAAAAGCCAGCACCAGGACCAACCAGGACCACACCGAACAGATTACCGAACAGATTACTCCGATCGGATCCGATCGGATCCCTCTGAAGGACCCATGGACCCATCCATCTATGTGAACGTTGAACGTTGTAAACCCTCTGTGTGTCTGTGTGTCCTTTCGTTCCGTCACTTTCTCCTCATCAATCAGCTATCAGCA

Full Affymetrix probeset data:

Annotations for 1623708_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime