FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623709_at:

>probe:Drosophila_2:1623709_at:172:417; Interrogation_Position=112; Antisense; GAGCGATTCGACTATGTACTTGGCA
>probe:Drosophila_2:1623709_at:56:645; Interrogation_Position=19; Antisense; TCTTCGGATGGTAGCACGGTCTTAT
>probe:Drosophila_2:1623709_at:351:553; Interrogation_Position=216; Antisense; GGAGCAGCACTTGGTGTTCCAGTAC
>probe:Drosophila_2:1623709_at:600:585; Interrogation_Position=242; Antisense; TGGACAATACGCTGCATGACATCAT
>probe:Drosophila_2:1623709_at:597:55; Interrogation_Position=257; Antisense; ATGACATCATCCAGACGTGTGCGTT
>probe:Drosophila_2:1623709_at:231:477; Interrogation_Position=279; Antisense; GTTTGTGGTCAAGCGGAATCCCGGT
>probe:Drosophila_2:1623709_at:535:235; Interrogation_Position=295; Antisense; AATCCCGGTGAGTGCGAGAACATCC
>probe:Drosophila_2:1623709_at:688:359; Interrogation_Position=371; Antisense; GCAAGCCCATCAACGTGTGTGACGA
>probe:Drosophila_2:1623709_at:436:275; Interrogation_Position=39; Antisense; CTTATATACCGCTGTGATGATTCCA
>probe:Drosophila_2:1623709_at:36:213; Interrogation_Position=437; Antisense; AAGACAATCCGGATGCAGATGCTGA
>probe:Drosophila_2:1623709_at:682:205; Interrogation_Position=500; Antisense; AAGCGGAGACCACAACAGCGGAGCC
>probe:Drosophila_2:1623709_at:157:317; Interrogation_Position=522; Antisense; GCCGGCTAGCTCCAAATTAAGTGAA
>probe:Drosophila_2:1623709_at:519:443; Interrogation_Position=54; Antisense; GATGATTCCAGATGCGCTGACCAGC
>probe:Drosophila_2:1623709_at:622:297; Interrogation_Position=68; Antisense; CGCTGACCAGCTCTGATTTTTCAAT

Paste this into a BLAST search page for me
GAGCGATTCGACTATGTACTTGGCATCTTCGGATGGTAGCACGGTCTTATGGAGCAGCACTTGGTGTTCCAGTACTGGACAATACGCTGCATGACATCATATGACATCATCCAGACGTGTGCGTTGTTTGTGGTCAAGCGGAATCCCGGTAATCCCGGTGAGTGCGAGAACATCCGCAAGCCCATCAACGTGTGTGACGACTTATATACCGCTGTGATGATTCCAAAGACAATCCGGATGCAGATGCTGAAAGCGGAGACCACAACAGCGGAGCCGCCGGCTAGCTCCAAATTAAGTGAAGATGATTCCAGATGCGCTGACCAGCCGCTGACCAGCTCTGATTTTTCAAT

Full Affymetrix probeset data:

Annotations for 1623709_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720