FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623710_at:

>probe:Drosophila_2:1623710_at:38:143; Interrogation_Position=6268; Antisense; ACTGCTAGCAGGTGCTATCCTGGTT
>probe:Drosophila_2:1623710_at:12:591; Interrogation_Position=6288; Antisense; TGGTTCCAGCGATCCTAAATGTCAA
>probe:Drosophila_2:1623710_at:706:635; Interrogation_Position=6334; Antisense; TCGACCAGAGCTCCTTTAACTACTT
>probe:Drosophila_2:1623710_at:450:271; Interrogation_Position=6349; Antisense; TTAACTACTTCCAGGCCCAATTGTT
>probe:Drosophila_2:1623710_at:140:341; Interrogation_Position=6369; Antisense; TTGTTACCCGGGATCCACGGATAGG
>probe:Drosophila_2:1623710_at:588:413; Interrogation_Position=6425; Antisense; GACCAAGGTGTTATCCAGGCTCATC
>probe:Drosophila_2:1623710_at:341:687; Interrogation_Position=6509; Antisense; TATACTGCTACCCAGGATCCATCGA
>probe:Drosophila_2:1623710_at:525:259; Interrogation_Position=6596; Antisense; CACTGAGTGATCCTGGCTACGATAG
>probe:Drosophila_2:1623710_at:547:239; Interrogation_Position=6657; Antisense; AATCAATCAATTGGCCTTCACCGAC
>probe:Drosophila_2:1623710_at:98:399; Interrogation_Position=6679; Antisense; GACAACAACGTCTTCGAGCTCGATG
>probe:Drosophila_2:1623710_at:498:409; Interrogation_Position=6748; Antisense; GACGAGGATGACCTCCTGTCTAAGA
>probe:Drosophila_2:1623710_at:494:35; Interrogation_Position=6775; Antisense; ATCATAAAGCGCGAGTCCAACCAGG
>probe:Drosophila_2:1623710_at:282:161; Interrogation_Position=6813; Antisense; ACAAGAAGTGATTTCCCTGACCCTC
>probe:Drosophila_2:1623710_at:241:609; Interrogation_Position=6830; Antisense; TGACCCTCGGAGTTAGAACTGGCAT

Paste this into a BLAST search page for me
ACTGCTAGCAGGTGCTATCCTGGTTTGGTTCCAGCGATCCTAAATGTCAATCGACCAGAGCTCCTTTAACTACTTTTAACTACTTCCAGGCCCAATTGTTTTGTTACCCGGGATCCACGGATAGGGACCAAGGTGTTATCCAGGCTCATCTATACTGCTACCCAGGATCCATCGACACTGAGTGATCCTGGCTACGATAGAATCAATCAATTGGCCTTCACCGACGACAACAACGTCTTCGAGCTCGATGGACGAGGATGACCTCCTGTCTAAGAATCATAAAGCGCGAGTCCAACCAGGACAAGAAGTGATTTCCCTGACCCTCTGACCCTCGGAGTTAGAACTGGCAT

Full Affymetrix probeset data:

Annotations for 1623710_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720