FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623711_at:

>probe:Drosophila_2:1623711_at:117:681; Interrogation_Position=1011; Antisense; TATGGTCAAGTTCTGCGGTTGTCAC
>probe:Drosophila_2:1623711_at:543:329; Interrogation_Position=1025; Antisense; GCGGTTGTCACACGTACTTTTTTGA
>probe:Drosophila_2:1623711_at:96:183; Interrogation_Position=1135; Antisense; AAAAGTACCCAGTGCTACTGTCCGC
>probe:Drosophila_2:1623711_at:14:599; Interrogation_Position=1153; Antisense; TGTCCGCTAACCTGTGAACACATTG
>probe:Drosophila_2:1623711_at:29:489; Interrogation_Position=1186; Antisense; GTACAGTTGACGAATTTTCCCCTGG
>probe:Drosophila_2:1623711_at:579:717; Interrogation_Position=1202; Antisense; TTCCCCTGGAACTGAATATGCCGGT
>probe:Drosophila_2:1623711_at:225:627; Interrogation_Position=1220; Antisense; TGCCGGTGGCCGATAAGTTCTATTC
>probe:Drosophila_2:1623711_at:284:243; Interrogation_Position=1285; Antisense; AATTCGTTTAGCTACCGCCGATTGC
>probe:Drosophila_2:1623711_at:402:465; Interrogation_Position=1304; Antisense; GATTGCGACGTGACTTGCTTTCCAA
>probe:Drosophila_2:1623711_at:122:593; Interrogation_Position=1340; Antisense; TGGTGTCTAATCTAGGCAGCGCCTT
>probe:Drosophila_2:1623711_at:601:123; Interrogation_Position=1357; Antisense; AGCGCCTTCAGTCTTTTTGTGGGCA
>probe:Drosophila_2:1623711_at:536:389; Interrogation_Position=1456; Antisense; GAAACTCGCAGTCAGATGCTTCACA
>probe:Drosophila_2:1623711_at:656:377; Interrogation_Position=1482; Antisense; GAAGCCGAAGTTCGCGTGGCCCAAA
>probe:Drosophila_2:1623711_at:688:703; Interrogation_Position=969; Antisense; TTATGTATACCCTAACTGCGAGCTA

Paste this into a BLAST search page for me
TATGGTCAAGTTCTGCGGTTGTCACGCGGTTGTCACACGTACTTTTTTGAAAAAGTACCCAGTGCTACTGTCCGCTGTCCGCTAACCTGTGAACACATTGGTACAGTTGACGAATTTTCCCCTGGTTCCCCTGGAACTGAATATGCCGGTTGCCGGTGGCCGATAAGTTCTATTCAATTCGTTTAGCTACCGCCGATTGCGATTGCGACGTGACTTGCTTTCCAATGGTGTCTAATCTAGGCAGCGCCTTAGCGCCTTCAGTCTTTTTGTGGGCAGAAACTCGCAGTCAGATGCTTCACAGAAGCCGAAGTTCGCGTGGCCCAAATTATGTATACCCTAACTGCGAGCTA

Full Affymetrix probeset data:

Annotations for 1623711_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720