FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623712_at:

>probe:Drosophila_2:1623712_at:40:655; Interrogation_Position=4149; Antisense; TAATCTGGGACCTGGTCACGGGCAA
>probe:Drosophila_2:1623712_at:302:495; Interrogation_Position=4163; Antisense; GTCACGGGCAACTGCAAGAGCACCT
>probe:Drosophila_2:1623712_at:491:213; Interrogation_Position=4178; Antisense; AAGAGCACCTTGATCGGCCACAATG
>probe:Drosophila_2:1623712_at:64:579; Interrogation_Position=4193; Antisense; GGCCACAATGCACCGGTAACGTTCT
>probe:Drosophila_2:1623712_at:252:493; Interrogation_Position=4208; Antisense; GTAACGTTCTTGAAGCTGGATCCAT
>probe:Drosophila_2:1623712_at:649:507; Interrogation_Position=4241; Antisense; GTGCTGCTCTCCTACGACAAGGAGG
>probe:Drosophila_2:1623712_at:655:11; Interrogation_Position=4272; Antisense; ATTCGGCCGTCCGTATGTGGGAGTT
>probe:Drosophila_2:1623712_at:578:287; Interrogation_Position=4318; Antisense; CGTGTTTAAGCCACCGGCGCAAGTG
>probe:Drosophila_2:1623712_at:406:511; Interrogation_Position=4340; Antisense; GTGAGCACTTGTGAGATTCTGCCGA
>probe:Drosophila_2:1623712_at:139:463; Interrogation_Position=4354; Antisense; GATTCTGCCGAACGGAGCCTTCGTG
>probe:Drosophila_2:1623712_at:82:593; Interrogation_Position=4377; Antisense; TGGTGCTGGCTCTCAAGGATCGCAA
>probe:Drosophila_2:1623712_at:397:619; Interrogation_Position=4407; Antisense; TGCTGACCCTGGCTTTGAAGAACTA
>probe:Drosophila_2:1623712_at:18:283; Interrogation_Position=4451; Antisense; CTCGACGATGACTGTGGCACTCTTT
>probe:Drosophila_2:1623712_at:241:521; Interrogation_Position=4464; Antisense; GTGGCACTCTTTACGGCAATCCAGA

Paste this into a BLAST search page for me
TAATCTGGGACCTGGTCACGGGCAAGTCACGGGCAACTGCAAGAGCACCTAAGAGCACCTTGATCGGCCACAATGGGCCACAATGCACCGGTAACGTTCTGTAACGTTCTTGAAGCTGGATCCATGTGCTGCTCTCCTACGACAAGGAGGATTCGGCCGTCCGTATGTGGGAGTTCGTGTTTAAGCCACCGGCGCAAGTGGTGAGCACTTGTGAGATTCTGCCGAGATTCTGCCGAACGGAGCCTTCGTGTGGTGCTGGCTCTCAAGGATCGCAATGCTGACCCTGGCTTTGAAGAACTACTCGACGATGACTGTGGCACTCTTTGTGGCACTCTTTACGGCAATCCAGA

Full Affymetrix probeset data:

Annotations for 1623712_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720