FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623713_at:

>probe:Drosophila_2:1623713_at:27:711; Interrogation_Position=106; Antisense; TTAAGGCCACTAAATCAAGCGGATT
>probe:Drosophila_2:1623713_at:248:51; Interrogation_Position=13; Antisense; ATGCGTACTTTGTGTGCTCTAAGTT
>probe:Drosophila_2:1623713_at:331:703; Interrogation_Position=186; Antisense; TTATTCACCAGATCCCACCAAAAAG
>probe:Drosophila_2:1623713_at:347:517; Interrogation_Position=24; Antisense; GTGTGCTCTAAGTTTGATCGCTTTT
>probe:Drosophila_2:1623713_at:104:561; Interrogation_Position=267; Antisense; GGAAACCGAGGAACCTTCTGGAGAG
>probe:Drosophila_2:1623713_at:209:561; Interrogation_Position=291; Antisense; GGAAACTCACAGTCCTACGGGAGAG
>probe:Drosophila_2:1623713_at:448:519; Interrogation_Position=385; Antisense; GTGGATAAACCAACTGATGTCATAC
>probe:Drosophila_2:1623713_at:622:449; Interrogation_Position=39; Antisense; GATCGCTTTTATGGGCATAACCCTA
>probe:Drosophila_2:1623713_at:570:243; Interrogation_Position=415; Antisense; AATTTTCTAAAATATCCCGAGCACG
>probe:Drosophila_2:1623713_at:176:45; Interrogation_Position=428; Antisense; ATCCCGAGCACGAAGCTGATTTTAA
>probe:Drosophila_2:1623713_at:294:219; Interrogation_Position=451; Antisense; AAGTCTTATCCAAGGTTTGCAATCC
>probe:Drosophila_2:1623713_at:550:479; Interrogation_Position=465; Antisense; GTTTGCAATCCTTCGAAATGGCTAT
>probe:Drosophila_2:1623713_at:341:509; Interrogation_Position=490; Antisense; GTGCATCACATGAACTTGGACTTTT
>probe:Drosophila_2:1623713_at:418:525; Interrogation_Position=51; Antisense; GGGCATAACCCTAATATCTACAAAG

Paste this into a BLAST search page for me
TTAAGGCCACTAAATCAAGCGGATTATGCGTACTTTGTGTGCTCTAAGTTTTATTCACCAGATCCCACCAAAAAGGTGTGCTCTAAGTTTGATCGCTTTTGGAAACCGAGGAACCTTCTGGAGAGGGAAACTCACAGTCCTACGGGAGAGGTGGATAAACCAACTGATGTCATACGATCGCTTTTATGGGCATAACCCTAAATTTTCTAAAATATCCCGAGCACGATCCCGAGCACGAAGCTGATTTTAAAAGTCTTATCCAAGGTTTGCAATCCGTTTGCAATCCTTCGAAATGGCTATGTGCATCACATGAACTTGGACTTTTGGGCATAACCCTAATATCTACAAAG

Full Affymetrix probeset data:

Annotations for 1623713_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720