FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623714_at:

>probe:Drosophila_2:1623714_at:648:501; Interrogation_Position=163; Antisense; GTCGCAATCCGATAACGTGGCACGT
>probe:Drosophila_2:1623714_at:521:567; Interrogation_Position=181; Antisense; GGCACGTGAGCAAACTGCGGCAAAT
>probe:Drosophila_2:1623714_at:223:547; Interrogation_Position=227; Antisense; GGATGCCGCGGCCAATTGCCAAATG
>probe:Drosophila_2:1623714_at:474:259; Interrogation_Position=253; Antisense; CACGCCCGTGGAAGTCGAGGACATG
>probe:Drosophila_2:1623714_at:141:75; Interrogation_Position=270; Antisense; AGGACATGGCCTTGCCGTCGATGGA
>probe:Drosophila_2:1623714_at:537:553; Interrogation_Position=292; Antisense; GGAGCGTCTCATTCGAAAGGCCAAC
>probe:Drosophila_2:1623714_at:98:565; Interrogation_Position=373; Antisense; GGAATCTCAACTCTCCATCAAGGAG
>probe:Drosophila_2:1623714_at:25:77; Interrogation_Position=393; Antisense; AGGAGACCAAGTCCAAGCACCGCAG
>probe:Drosophila_2:1623714_at:211:441; Interrogation_Position=422; Antisense; GATGGAGTTCCAGTTCCGACCACAG
>probe:Drosophila_2:1623714_at:334:153; Interrogation_Position=443; Antisense; ACAGTGACTGCGAGCTGATCCTGGC
>probe:Drosophila_2:1623714_at:351:355; Interrogation_Position=480; Antisense; GCACATGCCGCGGAGAAGACACACG
>probe:Drosophila_2:1623714_at:77:519; Interrogation_Position=563; Antisense; GTGGTCGTTCTCATGGGCGTTCTCG
>probe:Drosophila_2:1623714_at:517:625; Interrogation_Position=638; Antisense; TGCCCGTTCGGATTTCAGTGTGAGT
>probe:Drosophila_2:1623714_at:69:267; Interrogation_Position=653; Antisense; CAGTGTGAGTATCTGGCTTCATTCA

Paste this into a BLAST search page for me
GTCGCAATCCGATAACGTGGCACGTGGCACGTGAGCAAACTGCGGCAAATGGATGCCGCGGCCAATTGCCAAATGCACGCCCGTGGAAGTCGAGGACATGAGGACATGGCCTTGCCGTCGATGGAGGAGCGTCTCATTCGAAAGGCCAACGGAATCTCAACTCTCCATCAAGGAGAGGAGACCAAGTCCAAGCACCGCAGGATGGAGTTCCAGTTCCGACCACAGACAGTGACTGCGAGCTGATCCTGGCGCACATGCCGCGGAGAAGACACACGGTGGTCGTTCTCATGGGCGTTCTCGTGCCCGTTCGGATTTCAGTGTGAGTCAGTGTGAGTATCTGGCTTCATTCA

Full Affymetrix probeset data:

Annotations for 1623714_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720