FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623717_at:

>probe:Drosophila_2:1623717_at:374:109; Interrogation_Position=1001; Antisense; AGAAGTTTTCACATCCGTCTGGATG
>probe:Drosophila_2:1623717_at:154:623; Interrogation_Position=1024; Antisense; TGCGCAAAAAATCCGTCTGGCCTTG
>probe:Drosophila_2:1623717_at:148:579; Interrogation_Position=1042; Antisense; GGCCTTGTCCAATTTTCGGCTGATT
>probe:Drosophila_2:1623717_at:519:601; Interrogation_Position=1102; Antisense; TGTAGATTTCTTTCGACTTCTCTCG
>probe:Drosophila_2:1623717_at:639:649; Interrogation_Position=1129; Antisense; TCAGAATTCTCTGCCGAAAACGGGA
>probe:Drosophila_2:1623717_at:248:389; Interrogation_Position=1152; Antisense; GAAACTTGACCAATGTATCCGATGT
>probe:Drosophila_2:1623717_at:36:47; Interrogation_Position=1168; Antisense; ATCCGATGTTAGTTGTCTGGACACC
>probe:Drosophila_2:1623717_at:21:587; Interrogation_Position=1185; Antisense; TGGACACCACATATCGTTTGCTCTG
>probe:Drosophila_2:1623717_at:425:281; Interrogation_Position=1205; Antisense; CTCTGCGCCGATCTTCAAAACAAGT
>probe:Drosophila_2:1623717_at:178:661; Interrogation_Position=1296; Antisense; TAACACCGGATTTGGCCATTTTACG
>probe:Drosophila_2:1623717_at:169:709; Interrogation_Position=1316; Antisense; TTACGTGGCCTTACTCACAGTGATT
>probe:Drosophila_2:1623717_at:263:605; Interrogation_Position=1336; Antisense; TGATTTCACCTGTTTGCGGCCCAAA
>probe:Drosophila_2:1623717_at:730:231; Interrogation_Position=1451; Antisense; AATGAAATGGCATCCGTCACGCAGT
>probe:Drosophila_2:1623717_at:478:259; Interrogation_Position=975; Antisense; CACTGGCACGCATCTTGGAAATTTT

Paste this into a BLAST search page for me
AGAAGTTTTCACATCCGTCTGGATGTGCGCAAAAAATCCGTCTGGCCTTGGGCCTTGTCCAATTTTCGGCTGATTTGTAGATTTCTTTCGACTTCTCTCGTCAGAATTCTCTGCCGAAAACGGGAGAAACTTGACCAATGTATCCGATGTATCCGATGTTAGTTGTCTGGACACCTGGACACCACATATCGTTTGCTCTGCTCTGCGCCGATCTTCAAAACAAGTTAACACCGGATTTGGCCATTTTACGTTACGTGGCCTTACTCACAGTGATTTGATTTCACCTGTTTGCGGCCCAAAAATGAAATGGCATCCGTCACGCAGTCACTGGCACGCATCTTGGAAATTTT

Full Affymetrix probeset data:

Annotations for 1623717_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720