FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623718_at:

>probe:Drosophila_2:1623718_at:340:549; Interrogation_Position=1020; Antisense; GGAGGAGCGTCTCAACTTTCACACG
>probe:Drosophila_2:1623718_at:464:195; Interrogation_Position=1120; Antisense; AACGTGTGGAAGACCCTGCACCGTG
>probe:Drosophila_2:1623718_at:460:631; Interrogation_Position=1285; Antisense; TCCGATGGCGGATCCAATGAGTCTT
>probe:Drosophila_2:1623718_at:315:347; Interrogation_Position=728; Antisense; GCATCCACATGCAACAGTCACTGAC
>probe:Drosophila_2:1623718_at:323:409; Interrogation_Position=750; Antisense; GACGAGCACTCTTCTACTCAATTTA
>probe:Drosophila_2:1623718_at:419:339; Interrogation_Position=783; Antisense; GCTAAAGACTTGGTACCGCCACATG
>probe:Drosophila_2:1623718_at:225:153; Interrogation_Position=803; Antisense; ACATGCAGACCTTCGTGGGCAGCTT
>probe:Drosophila_2:1623718_at:176:117; Interrogation_Position=823; Antisense; AGCTTCTCATATCTGGGACGGGCGC
>probe:Drosophila_2:1623718_at:406:407; Interrogation_Position=839; Antisense; GACGGGCGCAGTACAAGTTCCGCAA
>probe:Drosophila_2:1623718_at:567:197; Interrogation_Position=883; Antisense; AACGAGGCGGTCACCAAGGAGCTGC
>probe:Drosophila_2:1623718_at:170:123; Interrogation_Position=922; Antisense; AGCGCGCGCTATATGCTCTGCGAGA
>probe:Drosophila_2:1623718_at:277:449; Interrogation_Position=945; Antisense; GATCGAGTTGACCATAAACGCCTCC
>probe:Drosophila_2:1623718_at:87:317; Interrogation_Position=964; Antisense; GCCTCCTATCCGAACAGCAATGGTG
>probe:Drosophila_2:1623718_at:151:251; Interrogation_Position=981; Antisense; CAATGGTGCGAAGCTGAGCCGCGTT

Paste this into a BLAST search page for me
GGAGGAGCGTCTCAACTTTCACACGAACGTGTGGAAGACCCTGCACCGTGTCCGATGGCGGATCCAATGAGTCTTGCATCCACATGCAACAGTCACTGACGACGAGCACTCTTCTACTCAATTTAGCTAAAGACTTGGTACCGCCACATGACATGCAGACCTTCGTGGGCAGCTTAGCTTCTCATATCTGGGACGGGCGCGACGGGCGCAGTACAAGTTCCGCAAAACGAGGCGGTCACCAAGGAGCTGCAGCGCGCGCTATATGCTCTGCGAGAGATCGAGTTGACCATAAACGCCTCCGCCTCCTATCCGAACAGCAATGGTGCAATGGTGCGAAGCTGAGCCGCGTT

Full Affymetrix probeset data:

Annotations for 1623718_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720