FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623720_at:

>probe:Drosophila_2:1623720_at:261:479; Interrogation_Position=1004; Antisense; GTTTACTGAGTGATCACCATGGCCA
>probe:Drosophila_2:1623720_at:14:181; Interrogation_Position=1102; Antisense; AAACACCATCCACATCATCATGATA
>probe:Drosophila_2:1623720_at:206:369; Interrogation_Position=1137; Antisense; GAAGAGTAAGCCTAAGCCCGGTTCT
>probe:Drosophila_2:1623720_at:626:659; Interrogation_Position=1149; Antisense; TAAGCCCGGTTCTGTTATCAAGCCA
>probe:Drosophila_2:1623720_at:730:401; Interrogation_Position=1252; Antisense; GACTACAAGGACTTCTTTCAGGGAT
>probe:Drosophila_2:1623720_at:48:269; Interrogation_Position=1270; Antisense; CAGGGATTTCCCTTGGATGGCATGG
>probe:Drosophila_2:1623720_at:196:45; Interrogation_Position=1321; Antisense; ATCCCAGCAGCTCTCGGTATGAGGA
>probe:Drosophila_2:1623720_at:49:551; Interrogation_Position=1343; Antisense; GGAATTACCTAAGCGTTACTACATC
>probe:Drosophila_2:1623720_at:502:67; Interrogation_Position=1387; Antisense; ATGGCAACTGCGGAGGCTATCGAGT
>probe:Drosophila_2:1623720_at:261:595; Interrogation_Position=1416; Antisense; TGTGAGCATAGTGTTCTCGACATGA
>probe:Drosophila_2:1623720_at:438:707; Interrogation_Position=862; Antisense; TTACCACTGCGCTATTACCAAGCGG
>probe:Drosophila_2:1623720_at:585:561; Interrogation_Position=899; Antisense; GGAACGGTCACTGCCATGTCTACGA
>probe:Drosophila_2:1623720_at:651:363; Interrogation_Position=922; Antisense; GAACCAGTGTCCTACGATTTACCAA
>probe:Drosophila_2:1623720_at:132:393; Interrogation_Position=960; Antisense; GAAACCACCGTTTTTGCGACATGGA

Paste this into a BLAST search page for me
GTTTACTGAGTGATCACCATGGCCAAAACACCATCCACATCATCATGATAGAAGAGTAAGCCTAAGCCCGGTTCTTAAGCCCGGTTCTGTTATCAAGCCAGACTACAAGGACTTCTTTCAGGGATCAGGGATTTCCCTTGGATGGCATGGATCCCAGCAGCTCTCGGTATGAGGAGGAATTACCTAAGCGTTACTACATCATGGCAACTGCGGAGGCTATCGAGTTGTGAGCATAGTGTTCTCGACATGATTACCACTGCGCTATTACCAAGCGGGGAACGGTCACTGCCATGTCTACGAGAACCAGTGTCCTACGATTTACCAAGAAACCACCGTTTTTGCGACATGGA

Full Affymetrix probeset data:

Annotations for 1623720_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720