FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623722_at:

>probe:Drosophila_2:1623722_at:629:679; Interrogation_Position=2061; Antisense; TAGTGATCTCATTAGTTACGCATAA
>probe:Drosophila_2:1623722_at:162:33; Interrogation_Position=2082; Antisense; ATAATATCGGACATTTCGCTCGGCT
>probe:Drosophila_2:1623722_at:244:19; Interrogation_Position=2094; Antisense; ATTTCGCTCGGCTATGCGTGAACAA
>probe:Drosophila_2:1623722_at:219:351; Interrogation_Position=2144; Antisense; GCAAGCGAAGATGCATTCATCTCAT
>probe:Drosophila_2:1623722_at:627:179; Interrogation_Position=2268; Antisense; AAACACGAATGGCAACTTACAAGAT
>probe:Drosophila_2:1623722_at:303:161; Interrogation_Position=2286; Antisense; ACAAGATGTGCAGTATTTCGAAGAA
>probe:Drosophila_2:1623722_at:299:179; Interrogation_Position=2311; Antisense; AAACACCTGAACATAACCATCCATC
>probe:Drosophila_2:1623722_at:515:147; Interrogation_Position=2321; Antisense; ACATAACCATCCATCATCCATTAGA
>probe:Drosophila_2:1623722_at:59:423; Interrogation_Position=2354; Antisense; GAGACTACCTCCTAACACGATTAAT
>probe:Drosophila_2:1623722_at:74:369; Interrogation_Position=2406; Antisense; GAATGCGACTGAAATTACTGATTAT
>probe:Drosophila_2:1623722_at:204:237; Interrogation_Position=2500; Antisense; AATCGAAATCGGACTTGCTTTTATT
>probe:Drosophila_2:1623722_at:433:711; Interrogation_Position=2524; Antisense; TTCAATGTATTTCTCATCCCATCTC
>probe:Drosophila_2:1623722_at:611:45; Interrogation_Position=2539; Antisense; ATCCCATCTCTGTCTACTTTTAATA
>probe:Drosophila_2:1623722_at:516:133; Interrogation_Position=2567; Antisense; ACGGCTCTAACCTAAGGTTTCACTG

Paste this into a BLAST search page for me
TAGTGATCTCATTAGTTACGCATAAATAATATCGGACATTTCGCTCGGCTATTTCGCTCGGCTATGCGTGAACAAGCAAGCGAAGATGCATTCATCTCATAAACACGAATGGCAACTTACAAGATACAAGATGTGCAGTATTTCGAAGAAAAACACCTGAACATAACCATCCATCACATAACCATCCATCATCCATTAGAGAGACTACCTCCTAACACGATTAATGAATGCGACTGAAATTACTGATTATAATCGAAATCGGACTTGCTTTTATTTTCAATGTATTTCTCATCCCATCTCATCCCATCTCTGTCTACTTTTAATAACGGCTCTAACCTAAGGTTTCACTG

Full Affymetrix probeset data:

Annotations for 1623722_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720