FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623724_at:

>probe:Drosophila_2:1623724_at:245:161; Interrogation_Position=127; Antisense; ACAAGGTCCGTTTGGGTCATGCCAT
>probe:Drosophila_2:1623724_at:115:217; Interrogation_Position=174; Antisense; AAGTTGAGCTGGTTTCTCGGCCAAA
>probe:Drosophila_2:1623724_at:202:445; Interrogation_Position=201; Antisense; GATGAGGGACGCACTGAACCGCTGA
>probe:Drosophila_2:1623724_at:71:609; Interrogation_Position=251; Antisense; TGAGCTCTATTTTACGCGATTCGAC
>probe:Drosophila_2:1623724_at:314:179; Interrogation_Position=315; Antisense; AAACATCGGGCCAATCAGCATGCCG
>probe:Drosophila_2:1623724_at:635:441; Interrogation_Position=348; Antisense; GATGTGATCACCATGACGCTGGAGA
>probe:Drosophila_2:1623724_at:492:553; Interrogation_Position=404; Antisense; GGAGCTGATGAACCTCTGCGATCCA
>probe:Drosophila_2:1623724_at:700:641; Interrogation_Position=418; Antisense; TCTGCGATCCACTCAAGCTGAAAAT
>probe:Drosophila_2:1623724_at:22:185; Interrogation_Position=438; Antisense; AAAATGCTGCGCGATTGGGACGGCA
>probe:Drosophila_2:1623724_at:194:141; Interrogation_Position=457; Antisense; ACGGCAGTGCGCTCAGTGTGCAGCA
>probe:Drosophila_2:1623724_at:183:85; Interrogation_Position=471; Antisense; AGTGTGCAGCACCTGAAACTCGACC
>probe:Drosophila_2:1623724_at:252:613; Interrogation_Position=484; Antisense; TGAAACTCGACCTAGTCTCCTATAA
>probe:Drosophila_2:1623724_at:366:89; Interrogation_Position=497; Antisense; AGTCTCCTATAACATGCTGCAGCGG
>probe:Drosophila_2:1623724_at:77:551; Interrogation_Position=53; Antisense; GGAGAAATGCAAGCACCCCAACAGC

Paste this into a BLAST search page for me
ACAAGGTCCGTTTGGGTCATGCCATAAGTTGAGCTGGTTTCTCGGCCAAAGATGAGGGACGCACTGAACCGCTGATGAGCTCTATTTTACGCGATTCGACAAACATCGGGCCAATCAGCATGCCGGATGTGATCACCATGACGCTGGAGAGGAGCTGATGAACCTCTGCGATCCATCTGCGATCCACTCAAGCTGAAAATAAAATGCTGCGCGATTGGGACGGCAACGGCAGTGCGCTCAGTGTGCAGCAAGTGTGCAGCACCTGAAACTCGACCTGAAACTCGACCTAGTCTCCTATAAAGTCTCCTATAACATGCTGCAGCGGGGAGAAATGCAAGCACCCCAACAGC

Full Affymetrix probeset data:

Annotations for 1623724_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720