FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623725_at:

>probe:Drosophila_2:1623725_at:536:595; Interrogation_Position=363; Antisense; TGTGGCCAAAGAGTTCCGTATCCTG
>probe:Drosophila_2:1623725_at:198:93; Interrogation_Position=374; Antisense; AGTTCCGTATCCTGGTGAAGCTGCA
>probe:Drosophila_2:1623725_at:381:565; Interrogation_Position=453; Antisense; GGAATTCCGTGGTCCCATCGGGCAA
>probe:Drosophila_2:1623725_at:641:429; Interrogation_Position=472; Antisense; GGGCAATACGTACACGAACCGCAGC
>probe:Drosophila_2:1623725_at:610:85; Interrogation_Position=503; Antisense; AGTGCATCTATATTATCGCCCAGGG
>probe:Drosophila_2:1623725_at:682:43; Interrogation_Position=517; Antisense; ATCGCCCAGGGAGTTGCTATTGCAC
>probe:Drosophila_2:1623725_at:231:521; Interrogation_Position=597; Antisense; GTGGCATTTGGTGTGCGCTCACGAC
>probe:Drosophila_2:1623725_at:171:619; Interrogation_Position=626; Antisense; TGCATGTCTACTTCCGCGAGGAGAT
>probe:Drosophila_2:1623725_at:40:77; Interrogation_Position=644; Antisense; AGGAGATGCTCGAGTTCGCCCAGTT
>probe:Drosophila_2:1623725_at:540:463; Interrogation_Position=657; Antisense; GTTCGCCCAGTTCTGGAACTACAGG
>probe:Drosophila_2:1623725_at:84:337; Interrogation_Position=762; Antisense; GCTCCGGGACAATCTACGCTACAAG
>probe:Drosophila_2:1623725_at:314:81; Interrogation_Position=797; Antisense; AGGTGTCCCGATTAGATGCCACCGA
>probe:Drosophila_2:1623725_at:676:597; Interrogation_Position=861; Antisense; TGTCCTCATCGTGGCTGGAGATTCA
>probe:Drosophila_2:1623725_at:494:137; Interrogation_Position=929; Antisense; ACGTAGATCCGGCAAACATTTATAT

Paste this into a BLAST search page for me
TGTGGCCAAAGAGTTCCGTATCCTGAGTTCCGTATCCTGGTGAAGCTGCAGGAATTCCGTGGTCCCATCGGGCAAGGGCAATACGTACACGAACCGCAGCAGTGCATCTATATTATCGCCCAGGGATCGCCCAGGGAGTTGCTATTGCACGTGGCATTTGGTGTGCGCTCACGACTGCATGTCTACTTCCGCGAGGAGATAGGAGATGCTCGAGTTCGCCCAGTTGTTCGCCCAGTTCTGGAACTACAGGGCTCCGGGACAATCTACGCTACAAGAGGTGTCCCGATTAGATGCCACCGATGTCCTCATCGTGGCTGGAGATTCAACGTAGATCCGGCAAACATTTATAT

Full Affymetrix probeset data:

Annotations for 1623725_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720