FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623726_at:

>probe:Drosophila_2:1623726_at:39:431; Interrogation_Position=122; Antisense; GAGTAGCACGCATCGAATTCAATTG
>probe:Drosophila_2:1623726_at:229:247; Interrogation_Position=142; Antisense; AATTGTTCTGGCTGTGAAATGCACG
>probe:Drosophila_2:1623726_at:81:299; Interrogation_Position=194; Antisense; CGCCCTTTGCTCTAGGAGTCATATA
>probe:Drosophila_2:1623726_at:299:683; Interrogation_Position=215; Antisense; TATACCCAGAGGACAACTACGTGAT
>probe:Drosophila_2:1623726_at:339:669; Interrogation_Position=232; Antisense; TACGTGATGCGAGATCCTTTCCAAC
>probe:Drosophila_2:1623726_at:389:127; Interrogation_Position=264; Antisense; ACCTCGTTGGCAGTCAAAGCCGGAA
>probe:Drosophila_2:1623726_at:388:211; Interrogation_Position=328; Antisense; AAGACGGTGTGCAAGGATCCTGGCT
>probe:Drosophila_2:1623726_at:418:449; Interrogation_Position=343; Antisense; GATCCTGGCTGCAGTTTCTACTATA
>probe:Drosophila_2:1623726_at:456:477; Interrogation_Position=356; Antisense; GTTTCTACTATACAGCCTCTTTTTG
>probe:Drosophila_2:1623726_at:398:307; Interrogation_Position=371; Antisense; CCTCTTTTTGCTTGCCTTGTGGCAA
>probe:Drosophila_2:1623726_at:274:181; Interrogation_Position=406; Antisense; AAAAACTGGCCACCTGAGGCTCAAG
>probe:Drosophila_2:1623726_at:670:229; Interrogation_Position=447; Antisense; AATGTCTGTCAGTCAAGGCAGGCAA
>probe:Drosophila_2:1623726_at:663:381; Interrogation_Position=60; Antisense; TGAACGGTTACAGCTTCCCGAGGAG
>probe:Drosophila_2:1623726_at:179:183; Interrogation_Position=89; Antisense; AAAAGCCCATTGATCCCGAGGAAGA

Paste this into a BLAST search page for me
GAGTAGCACGCATCGAATTCAATTGAATTGTTCTGGCTGTGAAATGCACGCGCCCTTTGCTCTAGGAGTCATATATATACCCAGAGGACAACTACGTGATTACGTGATGCGAGATCCTTTCCAACACCTCGTTGGCAGTCAAAGCCGGAAAAGACGGTGTGCAAGGATCCTGGCTGATCCTGGCTGCAGTTTCTACTATAGTTTCTACTATACAGCCTCTTTTTGCCTCTTTTTGCTTGCCTTGTGGCAAAAAAACTGGCCACCTGAGGCTCAAGAATGTCTGTCAGTCAAGGCAGGCAATGAACGGTTACAGCTTCCCGAGGAGAAAAGCCCATTGATCCCGAGGAAGA

Full Affymetrix probeset data:

Annotations for 1623726_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720