FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623727_at:

>probe:Drosophila_2:1623727_at:448:73; Interrogation_Position=1017; Antisense; AGGAATCGAGGTTACCCACACCGAT
>probe:Drosophila_2:1623727_at:152:369; Interrogation_Position=1074; Antisense; GAATGAAACCCTGCGATTGATGCCA
>probe:Drosophila_2:1623727_at:642:469; Interrogation_Position=1102; Antisense; GTTCCGTTCAGCTCGAGGGAGACAC
>probe:Drosophila_2:1623727_at:96:107; Interrogation_Position=1121; Antisense; AGACACTGGAGGACTTGCGGCTATC
>probe:Drosophila_2:1623727_at:674:227; Interrogation_Position=1147; Antisense; AATGGAGTTGTCATCCCCAAGGGAA
>probe:Drosophila_2:1623727_at:208:377; Interrogation_Position=1228; Antisense; GAAGCAGCGCAGTTCAATCCCGAAA
>probe:Drosophila_2:1623727_at:420:183; Interrogation_Position=1267; Antisense; AAAATCCACGACAGGCATCCATACG
>probe:Drosophila_2:1623727_at:653:25; Interrogation_Position=1287; Antisense; ATACGCCTTCATTCCATTTTCAAAG
>probe:Drosophila_2:1623727_at:252:557; Interrogation_Position=1342; Antisense; GGACTGATGTCTTCGAAACTAGCTT
>probe:Drosophila_2:1623727_at:106:497; Interrogation_Position=1441; Antisense; GTCATAAAGCTTGCTCAGTCACCAC
>probe:Drosophila_2:1623727_at:84:127; Interrogation_Position=1461; Antisense; ACCACAACTGGCATTCGAACGACGA
>probe:Drosophila_2:1623727_at:411:257; Interrogation_Position=922; Antisense; CACACAGTGTATTATGCCCTCGTTT
>probe:Drosophila_2:1623727_at:165:701; Interrogation_Position=944; Antisense; TTTTGCTGGCCATGTTTCCTGAACA
>probe:Drosophila_2:1623727_at:483:657; Interrogation_Position=993; Antisense; TAAGGAGCACTTCCCTTTGGCCAAA

Paste this into a BLAST search page for me
AGGAATCGAGGTTACCCACACCGATGAATGAAACCCTGCGATTGATGCCAGTTCCGTTCAGCTCGAGGGAGACACAGACACTGGAGGACTTGCGGCTATCAATGGAGTTGTCATCCCCAAGGGAAGAAGCAGCGCAGTTCAATCCCGAAAAAAATCCACGACAGGCATCCATACGATACGCCTTCATTCCATTTTCAAAGGGACTGATGTCTTCGAAACTAGCTTGTCATAAAGCTTGCTCAGTCACCACACCACAACTGGCATTCGAACGACGACACACAGTGTATTATGCCCTCGTTTTTTTGCTGGCCATGTTTCCTGAACATAAGGAGCACTTCCCTTTGGCCAAA

Full Affymetrix probeset data:

Annotations for 1623727_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720