FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623731_at:

>probe:Drosophila_2:1623731_at:560:639; Interrogation_Position=239; Antisense; TCTGGGATACAAGCGATCGTCGTAC
>probe:Drosophila_2:1623731_at:564:117; Interrogation_Position=265; Antisense; AGCTGCCCTTCTATGCGGACAGTGA
>probe:Drosophila_2:1623731_at:706:445; Interrogation_Position=288; Antisense; GATGCGATTTCGGTTAGCCACTTTC
>probe:Drosophila_2:1623731_at:577:103; Interrogation_Position=322; Antisense; AGACCAACCACTTTGCGCTGGTAGA
>probe:Drosophila_2:1623731_at:169:125; Interrogation_Position=390; Antisense; AGCGCCTTCATGGATCGTGTGGGAC
>probe:Drosophila_2:1623731_at:326:43; Interrogation_Position=423; Antisense; ATCGATGGGTTCAAGCAGCGGCCGT
>probe:Drosophila_2:1623731_at:364:509; Interrogation_Position=452; Antisense; GTGCTCGTCGAAGATCAACTGGATT
>probe:Drosophila_2:1623731_at:10:669; Interrogation_Position=492; Antisense; TACTTTCCACGCTATATCCGTTCGA
>probe:Drosophila_2:1623731_at:147:305; Interrogation_Position=509; Antisense; CCGTTCGATCGAGTGTATTGCCAGA
>probe:Drosophila_2:1623731_at:671:89; Interrogation_Position=584; Antisense; AGTACTGCGCCGTAAAACTGGCTCA
>probe:Drosophila_2:1623731_at:158:195; Interrogation_Position=599; Antisense; AACTGGCTCATGCATTCGAATAAAC
>probe:Drosophila_2:1623731_at:121:603; Interrogation_Position=631; Antisense; TGATTTTGATCACCGCAGAGAAGTT
>probe:Drosophila_2:1623731_at:180:673; Interrogation_Position=668; Antisense; TACGCAGCTCTGGATTTGGGAAGAA
>probe:Drosophila_2:1623731_at:704:667; Interrogation_Position=729; Antisense; TACTAGTAGCGCCATTTAATCAAGA

Paste this into a BLAST search page for me
TCTGGGATACAAGCGATCGTCGTACAGCTGCCCTTCTATGCGGACAGTGAGATGCGATTTCGGTTAGCCACTTTCAGACCAACCACTTTGCGCTGGTAGAAGCGCCTTCATGGATCGTGTGGGACATCGATGGGTTCAAGCAGCGGCCGTGTGCTCGTCGAAGATCAACTGGATTTACTTTCCACGCTATATCCGTTCGACCGTTCGATCGAGTGTATTGCCAGAAGTACTGCGCCGTAAAACTGGCTCAAACTGGCTCATGCATTCGAATAAACTGATTTTGATCACCGCAGAGAAGTTTACGCAGCTCTGGATTTGGGAAGAATACTAGTAGCGCCATTTAATCAAGA

Full Affymetrix probeset data:

Annotations for 1623731_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720