FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623733_at:

>probe:Drosophila_2:1623733_at:580:511; Interrogation_Position=1271; Antisense; GTGGGCGATTCCGTAATGGGCTACA
>probe:Drosophila_2:1623733_at:269:339; Interrogation_Position=1290; Antisense; GCTACAACACCGGAGAGGCCAACAT
>probe:Drosophila_2:1623733_at:452:9; Interrogation_Position=1352; Antisense; ATTCCGGATGTAATTCTTGTGCGCA
>probe:Drosophila_2:1623733_at:257:145; Interrogation_Position=1380; Antisense; ACTACGATCGACAGACCAGACTCAG
>probe:Drosophila_2:1623733_at:711:263; Interrogation_Position=1396; Antisense; CAGACTCAGTCAGCGCGTGTGGAAG
>probe:Drosophila_2:1623733_at:406:71; Interrogation_Position=1440; Antisense; AGGCTACCGATGAGCGCAGCAAGTA
>probe:Drosophila_2:1623733_at:478:485; Interrogation_Position=1462; Antisense; GTACGACTACCACGAGTTTCTTGAC
>probe:Drosophila_2:1623733_at:458:77; Interrogation_Position=1503; Antisense; AGGATATCCGCGGTCAGGTCAACAT
>probe:Drosophila_2:1623733_at:493:127; Interrogation_Position=1552; Antisense; ACCAATCGAGGTACAGGCCGCTGGA
>probe:Drosophila_2:1623733_at:357:607; Interrogation_Position=1579; Antisense; TGATGTGCCCCAGATCACACTGGAG
>probe:Drosophila_2:1623733_at:557:549; Interrogation_Position=1658; Antisense; GGAGGTGCTGACGATACCGAGCCAC
>probe:Drosophila_2:1623733_at:479:295; Interrogation_Position=1675; Antisense; CGAGCCACAGTTGTAGTCCTTTTTT
>probe:Drosophila_2:1623733_at:83:33; Interrogation_Position=1706; Antisense; ATCATAACGCTTTCTTTTACCCATG
>probe:Drosophila_2:1623733_at:484:481; Interrogation_Position=1730; Antisense; GTATACCCTGTACATAATCGCTTAA

Paste this into a BLAST search page for me
GTGGGCGATTCCGTAATGGGCTACAGCTACAACACCGGAGAGGCCAACATATTCCGGATGTAATTCTTGTGCGCAACTACGATCGACAGACCAGACTCAGCAGACTCAGTCAGCGCGTGTGGAAGAGGCTACCGATGAGCGCAGCAAGTAGTACGACTACCACGAGTTTCTTGACAGGATATCCGCGGTCAGGTCAACATACCAATCGAGGTACAGGCCGCTGGATGATGTGCCCCAGATCACACTGGAGGGAGGTGCTGACGATACCGAGCCACCGAGCCACAGTTGTAGTCCTTTTTTATCATAACGCTTTCTTTTACCCATGGTATACCCTGTACATAATCGCTTAA

Full Affymetrix probeset data:

Annotations for 1623733_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720