Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623734_at:

>probe:Drosophila_2:1623734_at:316:437; Interrogation_Position=103; Antisense; GAGGAGATTGCCCAGAACCAGGCAA
>probe:Drosophila_2:1623734_at:89:265; Interrogation_Position=115; Antisense; CAGAACCAGGCAAACGAGAGGATGT
>probe:Drosophila_2:1623734_at:459:175; Interrogation_Position=126; Antisense; AAACGAGAGGATGTTGAGGGCAACT
>probe:Drosophila_2:1623734_at:424:279; Interrogation_Position=149; Antisense; CTCAAGTGGGATTGGAGGAGCACCT
>probe:Drosophila_2:1623734_at:399:131; Interrogation_Position=170; Antisense; ACCTGGTCATCTGCTTGGAGACGGA
>probe:Drosophila_2:1623734_at:380:591; Interrogation_Position=173; Antisense; TGGTCATCTGCTTGGAGACGGAAGC
>probe:Drosophila_2:1623734_at:337:351; Interrogation_Position=200; Antisense; GCAGCTTCTACTGGCACTCGCAGTA
>probe:Drosophila_2:1623734_at:246:173; Interrogation_Position=24; Antisense; AAAGAACTTATTGGCCAAAATGCTG
>probe:Drosophila_2:1623734_at:243:167; Interrogation_Position=41; Antisense; AAATGCTGCAGCGATTTGGCAAAAA
>probe:Drosophila_2:1623734_at:579:327; Interrogation_Position=51; Antisense; GCGATTTGGCAAAAACAGCTCACAA
>probe:Drosophila_2:1623734_at:42:181; Interrogation_Position=63; Antisense; AAACAGCTCACAAGCCGACAGTCAG
>probe:Drosophila_2:1623734_at:614:203; Interrogation_Position=74; Antisense; AAGCCGACAGTCAGCGATACGATAG
>probe:Drosophila_2:1623734_at:690:153; Interrogation_Position=80; Antisense; ACAGTCAGCGATACGATAGCCTGGA
>probe:Drosophila_2:1623734_at:407:29; Interrogation_Position=90; Antisense; ATACGATAGCCTGGAGGAGATTGCC

Paste this into a BLAST search page for me
GAGGAGATTGCCCAGAACCAGGCAACAGAACCAGGCAAACGAGAGGATGTAAACGAGAGGATGTTGAGGGCAACTCTCAAGTGGGATTGGAGGAGCACCTACCTGGTCATCTGCTTGGAGACGGATGGTCATCTGCTTGGAGACGGAAGCGCAGCTTCTACTGGCACTCGCAGTAAAAGAACTTATTGGCCAAAATGCTGAAATGCTGCAGCGATTTGGCAAAAAGCGATTTGGCAAAAACAGCTCACAAAAACAGCTCACAAGCCGACAGTCAGAAGCCGACAGTCAGCGATACGATAGACAGTCAGCGATACGATAGCCTGGAATACGATAGCCTGGAGGAGATTGCC

Full Affymetrix probeset data:

Annotations for 1623734_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime