FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623735_at:

>probe:Drosophila_2:1623735_at:402:209; Interrogation_Position=1012; Antisense; AAGCAGTTGGCCCAGGGACTCAGCC
>probe:Drosophila_2:1623735_at:482:261; Interrogation_Position=1024; Antisense; CAGGGACTCAGCCTGACCGAAACGC
>probe:Drosophila_2:1623735_at:250:609; Interrogation_Position=1037; Antisense; TGACCGAAACGCAGGTTAAGGTTTG
>probe:Drosophila_2:1623735_at:457:115; Interrogation_Position=1117; Antisense; AGCGACACCAAGAGCAACAAGGGCA
>probe:Drosophila_2:1623735_at:705:309; Interrogation_Position=1124; Antisense; CCAAGAGCAACAAGGGCAGCTCCTC
>probe:Drosophila_2:1623735_at:706:73; Interrogation_Position=1175; Antisense; AGGACGATGCCAAGCACGATGGGTC
>probe:Drosophila_2:1623735_at:355:49; Interrogation_Position=1181; Antisense; ATGCCAAGCACGATGGGTCGCAGCA
>probe:Drosophila_2:1623735_at:309:65; Interrogation_Position=1193; Antisense; ATGGGTCGCAGCACAGCTACGAGGA
>probe:Drosophila_2:1623735_at:713:409; Interrogation_Position=1282; Antisense; GACGACTACGGCAGTGAAATGGATG
>probe:Drosophila_2:1623735_at:563:167; Interrogation_Position=1298; Antisense; AAATGGATGCGGAGGAGCACCAACG
>probe:Drosophila_2:1623735_at:304:547; Interrogation_Position=1308; Antisense; GGAGGAGCACCAACGGCTGCGGGAG
>probe:Drosophila_2:1623735_at:174:93; Interrogation_Position=1367; Antisense; AGTTCATGCAGCAGAATGCCGGTGA
>probe:Drosophila_2:1623735_at:655:107; Interrogation_Position=1379; Antisense; AGAATGCCGGTGAGGCGGCCACCCT
>probe:Drosophila_2:1623735_at:600:111; Interrogation_Position=1499; Antisense; AGCAGCTTTATCTGCGGGAAAGAGA

Paste this into a BLAST search page for me
AAGCAGTTGGCCCAGGGACTCAGCCCAGGGACTCAGCCTGACCGAAACGCTGACCGAAACGCAGGTTAAGGTTTGAGCGACACCAAGAGCAACAAGGGCACCAAGAGCAACAAGGGCAGCTCCTCAGGACGATGCCAAGCACGATGGGTCATGCCAAGCACGATGGGTCGCAGCAATGGGTCGCAGCACAGCTACGAGGAGACGACTACGGCAGTGAAATGGATGAAATGGATGCGGAGGAGCACCAACGGGAGGAGCACCAACGGCTGCGGGAGAGTTCATGCAGCAGAATGCCGGTGAAGAATGCCGGTGAGGCGGCCACCCTAGCAGCTTTATCTGCGGGAAAGAGA

Full Affymetrix probeset data:

Annotations for 1623735_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720