Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623736_at:

>probe:Drosophila_2:1623736_at:100:217; Interrogation_Position=4079; Antisense; AAGTAAGACTTGCATAGAGTGCCAA
>probe:Drosophila_2:1623736_at:269:71; Interrogation_Position=4109; Antisense; AGGAAACCGAACAAATGCGCTAAAT
>probe:Drosophila_2:1623736_at:187:249; Interrogation_Position=4144; Antisense; TCAAAACGGAAACACGGCTTAATCT
>probe:Drosophila_2:1623736_at:281:299; Interrogation_Position=4176; Antisense; CGCCCAACCAATTGTTATTAATTAT
>probe:Drosophila_2:1623736_at:592:165; Interrogation_Position=4307; Antisense; AAATGCTTCCTCCTTTAGGCTTAGG
>probe:Drosophila_2:1623736_at:584:541; Interrogation_Position=4330; Antisense; GGATTACCTTTAAACGACACTCGCT
>probe:Drosophila_2:1623736_at:291:399; Interrogation_Position=4345; Antisense; GACACTCGCTCTAGGATATTGATTA
>probe:Drosophila_2:1623736_at:238:7; Interrogation_Position=4362; Antisense; ATTGATTACGATTCGATTCCCGGAA
>probe:Drosophila_2:1623736_at:100:463; Interrogation_Position=4376; Antisense; GATTCCCGGAAAATCGACTCGATTA
>probe:Drosophila_2:1623736_at:406:237; Interrogation_Position=4387; Antisense; AATCGACTCGATTATTACCTCTAAG
>probe:Drosophila_2:1623736_at:203:673; Interrogation_Position=4402; Antisense; TACCTCTAAGAGTTCAGCTAACGTT
>probe:Drosophila_2:1623736_at:437:473; Interrogation_Position=4413; Antisense; GTTCAGCTAACGTTTGTCTATTTCC
>probe:Drosophila_2:1623736_at:625:629; Interrogation_Position=4435; Antisense; TCCGTTTCCTCCCTATTGTATATTT
>probe:Drosophila_2:1623736_at:555:357; Interrogation_Position=4555; Antisense; GCAAAGAAAGTTTCTCCCATTAAAG

Paste this into a BLAST search page for me
AAGTAAGACTTGCATAGAGTGCCAAAGGAAACCGAACAAATGCGCTAAATTCAAAACGGAAACACGGCTTAATCTCGCCCAACCAATTGTTATTAATTATAAATGCTTCCTCCTTTAGGCTTAGGGGATTACCTTTAAACGACACTCGCTGACACTCGCTCTAGGATATTGATTAATTGATTACGATTCGATTCCCGGAAGATTCCCGGAAAATCGACTCGATTAAATCGACTCGATTATTACCTCTAAGTACCTCTAAGAGTTCAGCTAACGTTGTTCAGCTAACGTTTGTCTATTTCCTCCGTTTCCTCCCTATTGTATATTTGCAAAGAAAGTTTCTCCCATTAAAG

Full Affymetrix probeset data:

Annotations for 1623736_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime