Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623737_a_at:

>probe:Drosophila_2:1623737_a_at:381:55; Interrogation_Position=1000; Antisense; ATGATGGAACCTAACTTTACGCAAA
>probe:Drosophila_2:1623737_a_at:105:699; Interrogation_Position=1052; Antisense; TTTAGCCGACTCGTAATCTACCGAT
>probe:Drosophila_2:1623737_a_at:177:493; Interrogation_Position=1064; Antisense; GTAATCTACCGATGCCCAAGCAAAA
>probe:Drosophila_2:1623737_a_at:204:499; Interrogation_Position=615; Antisense; GTCTACGATATTACCAGGCGCTCCA
>probe:Drosophila_2:1623737_a_at:713:157; Interrogation_Position=643; Antisense; ACAATCACCTGAGCAGCTGGCTTAC
>probe:Drosophila_2:1623737_a_at:429:113; Interrogation_Position=693; Antisense; AGCACTGTGATCTTTCTCATTGGCA
>probe:Drosophila_2:1623737_a_at:715:97; Interrogation_Position=733; Antisense; AGAGCACTCGGGAGGTTACCTACGA
>probe:Drosophila_2:1623737_a_at:282:195; Interrogation_Position=783; Antisense; AACGGCCTAATGTTTCTCGAAGCGA
>probe:Drosophila_2:1623737_a_at:150:207; Interrogation_Position=802; Antisense; AAGCGAGCGCTATGACTGGCCAGAA
>probe:Drosophila_2:1623737_a_at:514:75; Interrogation_Position=832; Antisense; AGGAGGCTTTTCTGGAGACCGCACG
>probe:Drosophila_2:1623737_a_at:561:103; Interrogation_Position=847; Antisense; AGACCGCACGCAAGATTTACCAGAA
>probe:Drosophila_2:1623737_a_at:172:385; Interrogation_Position=869; Antisense; GAACATCCAGGAGGGTCGGCTCGAT
>probe:Drosophila_2:1623737_a_at:544:431; Interrogation_Position=906; Antisense; GAGTCCGGAGTTCAGCACAGGCCAT
>probe:Drosophila_2:1623737_a_at:459:321; Interrogation_Position=970; Antisense; GCGCCAAGGATCAGTGCTCGTGCTA

Paste this into a BLAST search page for me
ATGATGGAACCTAACTTTACGCAAATTTAGCCGACTCGTAATCTACCGATGTAATCTACCGATGCCCAAGCAAAAGTCTACGATATTACCAGGCGCTCCAACAATCACCTGAGCAGCTGGCTTACAGCACTGTGATCTTTCTCATTGGCAAGAGCACTCGGGAGGTTACCTACGAAACGGCCTAATGTTTCTCGAAGCGAAAGCGAGCGCTATGACTGGCCAGAAAGGAGGCTTTTCTGGAGACCGCACGAGACCGCACGCAAGATTTACCAGAAGAACATCCAGGAGGGTCGGCTCGATGAGTCCGGAGTTCAGCACAGGCCATGCGCCAAGGATCAGTGCTCGTGCTA

Full Affymetrix probeset data:

Annotations for 1623737_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime