Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623739_at:

>probe:Drosophila_2:1623739_at:668:277; Interrogation_Position=3761; Antisense; CTACCGGGAGCTGGCAAACGTGGCT
>probe:Drosophila_2:1623739_at:358:521; Interrogation_Position=3780; Antisense; GTGGCTCCCGCCTAAGATATCGCAA
>probe:Drosophila_2:1623739_at:59:659; Interrogation_Position=3792; Antisense; TAAGATATCGCAATCCCAATCCTCT
>probe:Drosophila_2:1623739_at:390:281; Interrogation_Position=3813; Antisense; CTCTTCAGACCAAGTCCATTCATGT
>probe:Drosophila_2:1623739_at:446:629; Interrogation_Position=3827; Antisense; TCCATTCATGTCGACCAAGCCAAGA
>probe:Drosophila_2:1623739_at:138:447; Interrogation_Position=3863; Antisense; GATGCTTCAGCTACTCGTTATCATT
>probe:Drosophila_2:1623739_at:694:475; Interrogation_Position=3879; Antisense; GTTATCATTATTTTTCATCTTACCG
>probe:Drosophila_2:1623739_at:453:695; Interrogation_Position=4008; Antisense; TTTAATCAAAACTCTTCTCCCGAAG
>probe:Drosophila_2:1623739_at:443:105; Interrogation_Position=4031; Antisense; AGACAAAAGTCTGCCTCGTTAGAAT
>probe:Drosophila_2:1623739_at:415:447; Interrogation_Position=4071; Antisense; GATGCGATCCAAATGCCATCCCAAT
>probe:Drosophila_2:1623739_at:285:309; Interrogation_Position=4091; Antisense; CCAATCACACCCAAATTCCAATAGA
>probe:Drosophila_2:1623739_at:609:63; Interrogation_Position=4154; Antisense; ATGTGTGTATATACGGCCCTAACGG
>probe:Drosophila_2:1623739_at:215:421; Interrogation_Position=4204; Antisense; GATGTAAACGTTGTCCGAATCGAAC
>probe:Drosophila_2:1623739_at:321:727; Interrogation_Position=4240; Antisense; TTGTGCATTCAAACCAGGATCGACA

Paste this into a BLAST search page for me
CTACCGGGAGCTGGCAAACGTGGCTGTGGCTCCCGCCTAAGATATCGCAATAAGATATCGCAATCCCAATCCTCTCTCTTCAGACCAAGTCCATTCATGTTCCATTCATGTCGACCAAGCCAAGAGATGCTTCAGCTACTCGTTATCATTGTTATCATTATTTTTCATCTTACCGTTTAATCAAAACTCTTCTCCCGAAGAGACAAAAGTCTGCCTCGTTAGAATGATGCGATCCAAATGCCATCCCAATCCAATCACACCCAAATTCCAATAGAATGTGTGTATATACGGCCCTAACGGGATGTAAACGTTGTCCGAATCGAACTTGTGCATTCAAACCAGGATCGACA

Full Affymetrix probeset data:

Annotations for 1623739_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime