FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623741_at:

>probe:Drosophila_2:1623741_at:607:559; Interrogation_Position=111; Antisense; GGAAATCGCACTGGACGGCTACATC
>probe:Drosophila_2:1623741_at:305:187; Interrogation_Position=136; Antisense; AACACGCCCCTGAATGGCAATGGCA
>probe:Drosophila_2:1623741_at:6:489; Interrogation_Position=15; Antisense; GTACGCCAATATTTCTCTACGTGTA
>probe:Drosophila_2:1623741_at:43:573; Interrogation_Position=172; Antisense; GGCGAAGGACCCACAAATTCGGTGA
>probe:Drosophila_2:1623741_at:274:163; Interrogation_Position=186; Antisense; AAATTCGGTGATTGCGTCCGGCAAA
>probe:Drosophila_2:1623741_at:256:327; Interrogation_Position=199; Antisense; GCGTCCGGCAAATCGAGCATTAAAT
>probe:Drosophila_2:1623741_at:109:419; Interrogation_Position=213; Antisense; GAGCATTAAATACCTATCGAATCTG
>probe:Drosophila_2:1623741_at:252:499; Interrogation_Position=278; Antisense; GTCCCAAGGGATTCGATTGGTCCAA
>probe:Drosophila_2:1623741_at:420:279; Interrogation_Position=31; Antisense; CTACGTGTAGTGTCGAGTCCGCCGA
>probe:Drosophila_2:1623741_at:413:351; Interrogation_Position=311; Antisense; GCAGCGGGAGTCATGGCAACCTAAT
>probe:Drosophila_2:1623741_at:43:269; Interrogation_Position=322; Antisense; CATGGCAACCTAATGGCGTCCAGTT
>probe:Drosophila_2:1623741_at:401:259; Interrogation_Position=371; Antisense; CACTGCTGACGACACACTCGTGTGG
>probe:Drosophila_2:1623741_at:232:159; Interrogation_Position=73; Antisense; ACAACCACAACGCTGCGGCGGACGA
>probe:Drosophila_2:1623741_at:78:557; Interrogation_Position=92; Antisense; GGACGACAACAACCGCGGCGGAAAT

Paste this into a BLAST search page for me
GGAAATCGCACTGGACGGCTACATCAACACGCCCCTGAATGGCAATGGCAGTACGCCAATATTTCTCTACGTGTAGGCGAAGGACCCACAAATTCGGTGAAAATTCGGTGATTGCGTCCGGCAAAGCGTCCGGCAAATCGAGCATTAAATGAGCATTAAATACCTATCGAATCTGGTCCCAAGGGATTCGATTGGTCCAACTACGTGTAGTGTCGAGTCCGCCGAGCAGCGGGAGTCATGGCAACCTAATCATGGCAACCTAATGGCGTCCAGTTCACTGCTGACGACACACTCGTGTGGACAACCACAACGCTGCGGCGGACGAGGACGACAACAACCGCGGCGGAAAT

Full Affymetrix probeset data:

Annotations for 1623741_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720