FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623742_at:

>probe:Drosophila_2:1623742_at:296:439; Interrogation_Position=1433; Antisense; GAGGCGGATGTTACCAGCTACGTGC
>probe:Drosophila_2:1623742_at:657:119; Interrogation_Position=1502; Antisense; AGCGAAGCCACCGAGCAAGAGCCTG
>probe:Drosophila_2:1623742_at:323:415; Interrogation_Position=1520; Antisense; GAGCCTGCCAGCACAAGCAACGTGG
>probe:Drosophila_2:1623742_at:726:645; Interrogation_Position=1617; Antisense; TCATCGAATCGCTGAAGGCCAAGCT
>probe:Drosophila_2:1623742_at:347:311; Interrogation_Position=1634; Antisense; GCCAAGCTGCGGCTCTACGAAAAGC
>probe:Drosophila_2:1623742_at:693:219; Interrogation_Position=1676; Antisense; AAGTGCCTGATCTGCATCGACGACT
>probe:Drosophila_2:1623742_at:173:39; Interrogation_Position=1691; Antisense; ATCGACGACTACAAGAATCCCGCCA
>probe:Drosophila_2:1623742_at:670:85; Interrogation_Position=1791; Antisense; AGTGCAACTCGATTACCACGCCGAA
>probe:Drosophila_2:1623742_at:266:413; Interrogation_Position=1817; Antisense; GACCTGCGACGAATCTACCTGTAGA
>probe:Drosophila_2:1623742_at:272:601; Interrogation_Position=1836; Antisense; TGTAGACGTCCATCACAGACTTGTT
>probe:Drosophila_2:1623742_at:324:337; Interrogation_Position=1867; Antisense; GCTGCCAAATTGCTTGCGCCATAAA
>probe:Drosophila_2:1623742_at:319:31; Interrogation_Position=1887; Antisense; ATAAAACAGGCTTTGCATCCCGACG
>probe:Drosophila_2:1623742_at:699:45; Interrogation_Position=1903; Antisense; ATCCCGACGCAGCTTTAGATGATAA
>probe:Drosophila_2:1623742_at:60:205; Interrogation_Position=1989; Antisense; AAGCCTACCATGTAACTATTGCAAT

Paste this into a BLAST search page for me
GAGGCGGATGTTACCAGCTACGTGCAGCGAAGCCACCGAGCAAGAGCCTGGAGCCTGCCAGCACAAGCAACGTGGTCATCGAATCGCTGAAGGCCAAGCTGCCAAGCTGCGGCTCTACGAAAAGCAAGTGCCTGATCTGCATCGACGACTATCGACGACTACAAGAATCCCGCCAAGTGCAACTCGATTACCACGCCGAAGACCTGCGACGAATCTACCTGTAGATGTAGACGTCCATCACAGACTTGTTGCTGCCAAATTGCTTGCGCCATAAAATAAAACAGGCTTTGCATCCCGACGATCCCGACGCAGCTTTAGATGATAAAAGCCTACCATGTAACTATTGCAAT

Full Affymetrix probeset data:

Annotations for 1623742_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720