FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623745_at:

>probe:Drosophila_2:1623745_at:431:111; Interrogation_Position=1010; Antisense; AGCACTGTTACCAGAGCCAGGTGGA
>probe:Drosophila_2:1623745_at:43:267; Interrogation_Position=1036; Antisense; CAGTTGACTCAGATGGGCTACAGCA
>probe:Drosophila_2:1623745_at:521:641; Interrogation_Position=1083; Antisense; TCTGCTCATATCTCTGGGCAATGTT
>probe:Drosophila_2:1623745_at:155:625; Interrogation_Position=1111; Antisense; TGCGCTGTAAGACTACTGGACCACT
>probe:Drosophila_2:1623745_at:347:557; Interrogation_Position=1152; Antisense; GGACTGAACTCCATTTGTACTGCTT
>probe:Drosophila_2:1623745_at:258:591; Interrogation_Position=1194; Antisense; TGGTCGAGGTTATCTGACGCCTATT
>probe:Drosophila_2:1623745_at:221:725; Interrogation_Position=679; Antisense; TTGAGCCGACTGAACTACTGCATGC
>probe:Drosophila_2:1623745_at:693:667; Interrogation_Position=694; Antisense; TACTGCATGCTACAGGCCTACGAAG
>probe:Drosophila_2:1623745_at:161:697; Interrogation_Position=736; Antisense; TTTCAGCAGGCGTCACAAGGCGCTA
>probe:Drosophila_2:1623745_at:97:51; Interrogation_Position=852; Antisense; ATGCGCTCTGCCAAGACGTGTAAAT
>probe:Drosophila_2:1623745_at:238:103; Interrogation_Position=899; Antisense; AGAGCGACCCTAATGCCGATTGCAG
>probe:Drosophila_2:1623745_at:361:533; Interrogation_Position=942; Antisense; GGTGATGACTTCTACTGCAACACAG
>probe:Drosophila_2:1623745_at:527:413; Interrogation_Position=966; Antisense; GACCAAGTGCAAGGACCGTCGATCC
>probe:Drosophila_2:1623745_at:345:511; Interrogation_Position=995; Antisense; GTGACGGACACTGCCAGCACTGTTA

Paste this into a BLAST search page for me
AGCACTGTTACCAGAGCCAGGTGGACAGTTGACTCAGATGGGCTACAGCATCTGCTCATATCTCTGGGCAATGTTTGCGCTGTAAGACTACTGGACCACTGGACTGAACTCCATTTGTACTGCTTTGGTCGAGGTTATCTGACGCCTATTTTGAGCCGACTGAACTACTGCATGCTACTGCATGCTACAGGCCTACGAAGTTTCAGCAGGCGTCACAAGGCGCTAATGCGCTCTGCCAAGACGTGTAAATAGAGCGACCCTAATGCCGATTGCAGGGTGATGACTTCTACTGCAACACAGGACCAAGTGCAAGGACCGTCGATCCGTGACGGACACTGCCAGCACTGTTA

Full Affymetrix probeset data:

Annotations for 1623745_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720