FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623747_at:

>probe:Drosophila_2:1623747_at:393:459; Interrogation_Position=1031; Antisense; GATATTATTTCCCACGCAGGAGCTG
>probe:Drosophila_2:1623747_at:31:569; Interrogation_Position=1096; Antisense; GGCAGCGTTTTAGCACCAGCTTTAT
>probe:Drosophila_2:1623747_at:678:403; Interrogation_Position=1140; Antisense; GACTATATGCGTCTGTTGTTCAGCA
>probe:Drosophila_2:1623747_at:364:203; Interrogation_Position=1167; Antisense; AAGCCGGATTCTCCAGTTCGGAATA
>probe:Drosophila_2:1623747_at:704:331; Interrogation_Position=1206; Antisense; GCGGCGGTGCTGAATCCCAAGATAA
>probe:Drosophila_2:1623747_at:352:595; Interrogation_Position=1268; Antisense; TGTGGTTGCCATGGACTACTTTAGC
>probe:Drosophila_2:1623747_at:377:519; Interrogation_Position=1305; Antisense; GTGGATCTGGCCATTCAAGTCAATG
>probe:Drosophila_2:1623747_at:702:217; Interrogation_Position=1321; Antisense; AAGTCAATGCGCACAAGGCTTTTGT
>probe:Drosophila_2:1623747_at:705:225; Interrogation_Position=1335; Antisense; AAGGCTTTTGTCATGGCTAACCGCG
>probe:Drosophila_2:1623747_at:49:33; Interrogation_Position=1400; Antisense; ATAATACTATAGATCCCTGCTTCAG
>probe:Drosophila_2:1623747_at:15:675; Interrogation_Position=866; Antisense; TAGTTTTCCCATCGGCTTTTACAAG
>probe:Drosophila_2:1623747_at:527:101; Interrogation_Position=896; Antisense; AGAGATCTACAGCTCGCTATTCCGG
>probe:Drosophila_2:1623747_at:367:9; Interrogation_Position=914; Antisense; ATTCCGGCTAATTCGCCAGGAGCTG
>probe:Drosophila_2:1623747_at:435:103; Interrogation_Position=946; Antisense; AGACCTATCGGCGTAATGTGGGCAA

Paste this into a BLAST search page for me
GATATTATTTCCCACGCAGGAGCTGGGCAGCGTTTTAGCACCAGCTTTATGACTATATGCGTCTGTTGTTCAGCAAAGCCGGATTCTCCAGTTCGGAATAGCGGCGGTGCTGAATCCCAAGATAATGTGGTTGCCATGGACTACTTTAGCGTGGATCTGGCCATTCAAGTCAATGAAGTCAATGCGCACAAGGCTTTTGTAAGGCTTTTGTCATGGCTAACCGCGATAATACTATAGATCCCTGCTTCAGTAGTTTTCCCATCGGCTTTTACAAGAGAGATCTACAGCTCGCTATTCCGGATTCCGGCTAATTCGCCAGGAGCTGAGACCTATCGGCGTAATGTGGGCAA

Full Affymetrix probeset data:

Annotations for 1623747_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720