FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623750_at:

>probe:Drosophila_2:1623750_at:265:99; Interrogation_Position=1143; Antisense; AGATGCATTTCTAGCCCGGATGGAT
>probe:Drosophila_2:1623750_at:453:65; Interrogation_Position=1162; Antisense; ATGGATTCCTGTTTGGAGCCGGCTA
>probe:Drosophila_2:1623750_at:627:571; Interrogation_Position=1182; Antisense; GGCTACGCCCATTAAGATCTGTCAT
>probe:Drosophila_2:1623750_at:359:663; Interrogation_Position=1221; Antisense; TAAACCCAAGTGTCCTCAAATTCGT
>probe:Drosophila_2:1623750_at:112:199; Interrogation_Position=1274; Antisense; AACGTTTTTGTGTCCACAGCATACG
>probe:Drosophila_2:1623750_at:148:465; Interrogation_Position=1316; Antisense; GATTGCCAATTGTATCGCAGTACTA
>probe:Drosophila_2:1623750_at:67:667; Interrogation_Position=1345; Antisense; TACTTGTACGACCTAGATCCTCTGG
>probe:Drosophila_2:1623750_at:193:449; Interrogation_Position=1360; Antisense; GATCCTCTGGCCAATCTAAATCATG
>probe:Drosophila_2:1623750_at:614:199; Interrogation_Position=1400; Antisense; AACCTCTTGTTTGGATCCTTCAAGG
>probe:Drosophila_2:1623750_at:579:73; Interrogation_Position=1422; Antisense; AGGACTCGTCAGCATCTGCGTAAGA
>probe:Drosophila_2:1623750_at:546:545; Interrogation_Position=1488; Antisense; GGATCGCATTCTGGTGTATTTATTA
>probe:Drosophila_2:1623750_at:114:661; Interrogation_Position=1562; Antisense; TAAAACGTTGCTGCTGTGCGCATTG
>probe:Drosophila_2:1623750_at:375:571; Interrogation_Position=1593; Antisense; GGCTAAGTGGCCAAACACGCACACA
>probe:Drosophila_2:1623750_at:303:151; Interrogation_Position=1615; Antisense; ACATACACGCACAGCTGGCAGGGAA

Paste this into a BLAST search page for me
AGATGCATTTCTAGCCCGGATGGATATGGATTCCTGTTTGGAGCCGGCTAGGCTACGCCCATTAAGATCTGTCATTAAACCCAAGTGTCCTCAAATTCGTAACGTTTTTGTGTCCACAGCATACGGATTGCCAATTGTATCGCAGTACTATACTTGTACGACCTAGATCCTCTGGGATCCTCTGGCCAATCTAAATCATGAACCTCTTGTTTGGATCCTTCAAGGAGGACTCGTCAGCATCTGCGTAAGAGGATCGCATTCTGGTGTATTTATTATAAAACGTTGCTGCTGTGCGCATTGGGCTAAGTGGCCAAACACGCACACAACATACACGCACAGCTGGCAGGGAA

Full Affymetrix probeset data:

Annotations for 1623750_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720