Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623752_at:

>probe:Drosophila_2:1623752_at:227:217; Interrogation_Position=1467; Antisense; AAGTTCTTGACCCATTACTCCAGTT
>probe:Drosophila_2:1623752_at:434:511; Interrogation_Position=1537; Antisense; GTGATATTTCGTACAATTCGCCGGG
>probe:Drosophila_2:1623752_at:338:11; Interrogation_Position=1552; Antisense; ATTCGCCGGGAATATCACTGTTGCA
>probe:Drosophila_2:1623752_at:354:347; Interrogation_Position=1579; Antisense; GCAGGCATCTCTACCAGGACGATAG
>probe:Drosophila_2:1623752_at:101:457; Interrogation_Position=1603; Antisense; GATACTTCTGCAACAAGAGCTCCCT
>probe:Drosophila_2:1623752_at:351:61; Interrogation_Position=1675; Antisense; ATGTAATGAGGCTTCCGGCCTATCG
>probe:Drosophila_2:1623752_at:721:577; Interrogation_Position=1691; Antisense; GGCCTATCGTCCTCTGGAGATGGTT
>probe:Drosophila_2:1623752_at:493:459; Interrogation_Position=1759; Antisense; GATTTACATTCCGTTTGGTGGGCCA
>probe:Drosophila_2:1623752_at:443:531; Interrogation_Position=1793; Antisense; GGGTAATCTCAACGATTTGCGCAAT
>probe:Drosophila_2:1623752_at:424:119; Interrogation_Position=1825; Antisense; AGCTGGATCGCAGAGGACGTCTTCC
>probe:Drosophila_2:1623752_at:92:703; Interrogation_Position=1854; Antisense; TTATCGGAAGACAGCGCTGCCGTTG
>probe:Drosophila_2:1623752_at:534:335; Interrogation_Position=1869; Antisense; GCTGCCGTTGCCAAGGATACTGTGC
>probe:Drosophila_2:1623752_at:373:9; Interrogation_Position=1960; Antisense; ATTGCCATGTTGAAGCACACGCCGT
>probe:Drosophila_2:1623752_at:602:181; Interrogation_Position=2032; Antisense; AAAACATTCCGGCACGTGTGCGCTG

Paste this into a BLAST search page for me
AAGTTCTTGACCCATTACTCCAGTTGTGATATTTCGTACAATTCGCCGGGATTCGCCGGGAATATCACTGTTGCAGCAGGCATCTCTACCAGGACGATAGGATACTTCTGCAACAAGAGCTCCCTATGTAATGAGGCTTCCGGCCTATCGGGCCTATCGTCCTCTGGAGATGGTTGATTTACATTCCGTTTGGTGGGCCAGGGTAATCTCAACGATTTGCGCAATAGCTGGATCGCAGAGGACGTCTTCCTTATCGGAAGACAGCGCTGCCGTTGGCTGCCGTTGCCAAGGATACTGTGCATTGCCATGTTGAAGCACACGCCGTAAAACATTCCGGCACGTGTGCGCTG

Full Affymetrix probeset data:

Annotations for 1623752_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime