FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623753_at:

>probe:Drosophila_2:1623753_at:264:133; Interrogation_Position=4355; Antisense; ACCCTGGAGTCGAGTGAGCGCATCA
>probe:Drosophila_2:1623753_at:60:537; Interrogation_Position=4414; Antisense; GGTCATCTACTTTGATTACCTGGAC
>probe:Drosophila_2:1623753_at:133:709; Interrogation_Position=4485; Antisense; TTACAAAACATCGACCGGTGGCAGT
>probe:Drosophila_2:1623753_at:522:569; Interrogation_Position=4504; Antisense; GGCAGTGGTCATGTACGACTACTAT
>probe:Drosophila_2:1623753_at:7:105; Interrogation_Position=4547; Antisense; AGACAGTTCTACAGGGCACCCAAAT
>probe:Drosophila_2:1623753_at:53:41; Interrogation_Position=4577; Antisense; ATCTGTGACATTTGCGAGCACGCCA
>probe:Drosophila_2:1623753_at:612:121; Interrogation_Position=4644; Antisense; AGCGACCTGATGACTACACGGCGAT
>probe:Drosophila_2:1623753_at:95:27; Interrogation_Position=4667; Antisense; ATAGCGGGTCATAGTTCAGGGTCAA
>probe:Drosophila_2:1623753_at:110:81; Interrogation_Position=4684; Antisense; AGGGTCAAGACACACAGCCATTCCA
>probe:Drosophila_2:1623753_at:625:257; Interrogation_Position=4707; Antisense; CACTGGCATCTGTGGTTATGGTTCT
>probe:Drosophila_2:1623753_at:242:475; Interrogation_Position=4721; Antisense; GTTATGGTTCTGTCGATGCTTTTGA
>probe:Drosophila_2:1623753_at:128:389; Interrogation_Position=4744; Antisense; GAAAACCCTTAGCTGTTAGACGATA
>probe:Drosophila_2:1623753_at:717:675; Interrogation_Position=4760; Antisense; TAGACGATACTGTTACCGCCACTTA
>probe:Drosophila_2:1623753_at:132:231; Interrogation_Position=4850; Antisense; AATGAATGCCGTGAACTAAACCTGT

Paste this into a BLAST search page for me
ACCCTGGAGTCGAGTGAGCGCATCAGGTCATCTACTTTGATTACCTGGACTTACAAAACATCGACCGGTGGCAGTGGCAGTGGTCATGTACGACTACTATAGACAGTTCTACAGGGCACCCAAATATCTGTGACATTTGCGAGCACGCCAAGCGACCTGATGACTACACGGCGATATAGCGGGTCATAGTTCAGGGTCAAAGGGTCAAGACACACAGCCATTCCACACTGGCATCTGTGGTTATGGTTCTGTTATGGTTCTGTCGATGCTTTTGAGAAAACCCTTAGCTGTTAGACGATATAGACGATACTGTTACCGCCACTTAAATGAATGCCGTGAACTAAACCTGT

Full Affymetrix probeset data:

Annotations for 1623753_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720