Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623754_s_at:

>probe:Drosophila_2:1623754_s_at:98:379; Interrogation_Position=254; Antisense; GAAGCTGGACGCATTTGTTGCAACA
>probe:Drosophila_2:1623754_s_at:115:553; Interrogation_Position=304; Antisense; GGACCAGTTCCACATCAGAATGCGC
>probe:Drosophila_2:1623754_s_at:368:167; Interrogation_Position=360; Antisense; AAATGTTGTCGTGCGCTGGAGCTGA
>probe:Drosophila_2:1623754_s_at:536:337; Interrogation_Position=437; Antisense; GCTCGAGTTCGTATTGGTCAACCCA
>probe:Drosophila_2:1623754_s_at:358:727; Interrogation_Position=450; Antisense; TTGGTCAACCCATTATGTCTGTCCG
>probe:Drosophila_2:1623754_s_at:250:633; Interrogation_Position=471; Antisense; TCCGCTCTAGCGATCGTTACAAGGC
>probe:Drosophila_2:1623754_s_at:503:475; Interrogation_Position=500; Antisense; GTTATTGAAGCTTTGCGGCGTGCTA
>probe:Drosophila_2:1623754_s_at:472:505; Interrogation_Position=519; Antisense; GTGCTAAGTTTAAGTTCCCTGGACG
>probe:Drosophila_2:1623754_s_at:91:471; Interrogation_Position=532; Antisense; GTTCCCTGGACGTCAAAAGATCTAT
>probe:Drosophila_2:1623754_s_at:457:209; Interrogation_Position=603; Antisense; AAGAACTTCGCGATGACAACCGCCT
>probe:Drosophila_2:1623754_s_at:382:133; Interrogation_Position=621; Antisense; ACCGCCTTGAGCCTGATGGTTGCAA
>probe:Drosophila_2:1623754_s_at:374:469; Interrogation_Position=639; Antisense; GTTGCAATGTGAAATACCGCCCAGA
>probe:Drosophila_2:1623754_s_at:185:269; Interrogation_Position=665; Antisense; CATGGCCCGATTGCCGCATGGGAAA
>probe:Drosophila_2:1623754_s_at:508:185; Interrogation_Position=770; Antisense; AAAATTACCATTTCCTGAGCACATA

Paste this into a BLAST search page for me
GAAGCTGGACGCATTTGTTGCAACAGGACCAGTTCCACATCAGAATGCGCAAATGTTGTCGTGCGCTGGAGCTGAGCTCGAGTTCGTATTGGTCAACCCATTGGTCAACCCATTATGTCTGTCCGTCCGCTCTAGCGATCGTTACAAGGCGTTATTGAAGCTTTGCGGCGTGCTAGTGCTAAGTTTAAGTTCCCTGGACGGTTCCCTGGACGTCAAAAGATCTATAAGAACTTCGCGATGACAACCGCCTACCGCCTTGAGCCTGATGGTTGCAAGTTGCAATGTGAAATACCGCCCAGACATGGCCCGATTGCCGCATGGGAAAAAAATTACCATTTCCTGAGCACATA

Full Affymetrix probeset data:

Annotations for 1623754_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime