FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1623756_at:

>probe:Drosophila_2:1623756_at:439:211; Interrogation_Position=179; Antisense; AAGACATCGTCATAACGGCAGCCCA
>probe:Drosophila_2:1623756_at:372:425; Interrogation_Position=220; Antisense; GAGACCGAGTTCCTCTCAGTGAGAG
>probe:Drosophila_2:1623756_at:17:427; Interrogation_Position=240; Antisense; GAGAGTCGGCTCATCGTTCACATTC
>probe:Drosophila_2:1623756_at:403:531; Interrogation_Position=284; Antisense; GGGTATCCAGTGTTCTGTTACACGA
>probe:Drosophila_2:1623756_at:469:589; Interrogation_Position=325; Antisense; TGGTCCAACGACATAGCCGTGATGA
>probe:Drosophila_2:1623756_at:92:513; Interrogation_Position=343; Antisense; GTGATGAGGCTTCAGTCCAAGCTCC
>probe:Drosophila_2:1623756_at:422:373; Interrogation_Position=374; Antisense; GAAGTGCAGTCAGTGTCATTCCCTT
>probe:Drosophila_2:1623756_at:448:375; Interrogation_Position=465; Antisense; GAAGAATTACCCCATGTCCATACTG
>probe:Drosophila_2:1623756_at:307:309; Interrogation_Position=513; Antisense; CCAGGATCAGTGTCGTAGGTCGTAC
>probe:Drosophila_2:1623756_at:647:223; Interrogation_Position=553; Antisense; AAGGACATGATCTGTGCGGCCGCTC
>probe:Drosophila_2:1623756_at:644:71; Interrogation_Position=609; Antisense; AGGTCCTCTGGTCTCCGGTAACAAG
>probe:Drosophila_2:1623756_at:322:185; Interrogation_Position=628; Antisense; AACAAGCTCGTTGGGATCGTGTCCT
>probe:Drosophila_2:1623756_at:566:251; Interrogation_Position=657; Antisense; CAAGGAGTGCGCTCATCCCGAATAT
>probe:Drosophila_2:1623756_at:87:21; Interrogation_Position=678; Antisense; ATATCCTGGAGTCTACGCTAACGTG

Paste this into a BLAST search page for me
AAGACATCGTCATAACGGCAGCCCAGAGACCGAGTTCCTCTCAGTGAGAGGAGAGTCGGCTCATCGTTCACATTCGGGTATCCAGTGTTCTGTTACACGATGGTCCAACGACATAGCCGTGATGAGTGATGAGGCTTCAGTCCAAGCTCCGAAGTGCAGTCAGTGTCATTCCCTTGAAGAATTACCCCATGTCCATACTGCCAGGATCAGTGTCGTAGGTCGTACAAGGACATGATCTGTGCGGCCGCTCAGGTCCTCTGGTCTCCGGTAACAAGAACAAGCTCGTTGGGATCGTGTCCTCAAGGAGTGCGCTCATCCCGAATATATATCCTGGAGTCTACGCTAACGTG

Full Affymetrix probeset data:

Annotations for 1623756_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720